New tumor marker

A technology of tumors and conjugates, which is applied in the field of tumor treatment and tumor metastasis, and can solve the problems of not mentioning the correlation of tumor metastasis, not defining the normal and abnormal content range, and not identifying the existence form of Hsp90α

Active Publication Date: 2014-04-02
TSINGHUA UNIV +1
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this article also did not identify the form of Hsp90α in the blood of tumor patients, nor did it mention its correlation with tumor metastasis; in addition, this article only studied non-small cell lung cancer, breast cancer, liver cancer, pancreas The correlation and specificity between cancer and plasma Hsp90α are not involved; and this article only qualitatively studies the changes of serum Hsp90α levels in tumor patients, the changes of its absolute content, and the normal and prognostic factors necessary for tumor diagnosis and prognosis. The abnormal content range is not defined

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New tumor marker
  • New tumor marker
  • New tumor marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0113] Example 1: Collection and preparation of mouse plasma samples, and detection of plasma Hsp90α

[0114] Balb / c mice with an average body weight of about 20 grams (purchased from Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd.) were selected and randomly divided into two groups with 3 mice in each group, one of which was implanted with H22 mouse liver cancer cells in the armpit. (CCTCC, ID: GDC091) 10 cells per access 6 A control group was not inoculated with tumors. When the tumor diameter of the mice grew to an average of 2 cm (about 20 days), blood was collected from the fundus venous plexus, and anticoagulants were added to the blood to avoid hemolysis. Samples were recollected if hemolysis occurred. The whole blood was collected and centrifuged twice at 6000g at 4°C. The supernatant was collected, and the content of Hsp90α in the plasma was detected by western blotting. The antibody was Rabbit anti-human Hsp90αpAb (Labvasion). The BCA method (Pierce) ...

Embodiment 2

[0115] Example 2: Collection and preparation of plasma samples from normal and tumor patients, and detection of plasma Hsp90α

[0116] Take whole blood from normal people or cancer patients and send it to the laboratory within 24 hours under low temperature conditions (about 4 °C). Hemolysis must be avoided. Centrifuge twice at 4°C and 6000g, take the supernatant, and detect the content of Hsp90α in plasma by western blotting method. The test results will be compared with clinical diagnosis to verify the correlation between the content of Hsp90α in plasma and the degree of tumor malignancy.

[0117] The specific operation method of western blot detection is as follows: the plasma sample is mixed with the loading buffer 1:1, and 1-2 μl of the sample is loaded for SDS-PAGE. The primary antibody is a specific antibody that recognizes plasma Hsp90α (rat monoclonal antibody SPA). -840, Stressgen), the secondary antibody was horseradish peroxidase-conjugated goat anti-rat antibody ...

Embodiment 3

[0118] Example 3: Preparation of Hsp90α-specific rabbit polyclonal antibodies and mouse monoclonal antibodies

[0119] Primers (synthesized from Invitrogen) consisting of the nucleotide sequences of Hsp90α-Sal1-Re:ACGCGTCGACTTAGTCTACTTCTTCCATGC (SEQ ID No. 8) and Hsp90α-Sph1-For:ACATGCATGCATGCCTGAGGAAAC CCAGACC (SEQ ID No. 9) and Pfu DNA polymerase were used (Source: NEB) The full-length Hsp90α sequence was amplified from a human liver cDNA library (Source: Stratagene), and the fragment and pQE80L vector (Source: Qiagen) were double-digested using Sph1 and Sal1 (Source: NEB) to obtain Fragments were ligated using T4 ligase (source: NEB). The ligation product was transformed into Top10 E. coli competent cells (source: Transgen) for amplification and verification, and the verified plasmid was then transformed into BL21DE3 E. coli competent cells (source: Transgen) for expression to obtain recombinant human Hsp90α protein. Purification method of recombinant human Hsp90α protein:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of tumor diagnosis and treatment, and particularly relates to a polypeptide in blood plasma with an amino acid sequence as shown in SEQ ID No.1. The polypeptide can be used as a tumor marker, and can be used in methods and kits for diagnosing tumorigenesis and tumor metastasis. The invention also relates to a method and a drug for treating tumor and tumor metastasis.

Description

[0001] This application is a divisional application of a Chinese patent application with an application date of July 7, 2009, an application number of 200910158747.9, and an invention title of "a new tumor marker". technical field [0002] The present invention relates to the field of tumor diagnosis and treatment, in particular to a new tumor marker, a method and a kit for diagnosing tumor occurrence and metastasis, and a method and medicament for treating tumor and tumor metastasis. Background technique [0003] Currently, approximately 11 million people worldwide are diagnosed with tumors every year. And it is expected that there will be 16 million new cases every year by 2020. In 2005, of the 58 million total deaths in the world, 7.6 million were caused by cancer (about 13% of the total deaths), and this number is still increasing year by year. It is expected that by 2015, there will be Nine million people die from cancer, which will reach 11.4 million by 2030 (World He...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/47G01N33/68A61K39/395A61P35/04
CPCA61K2039/505C07K14/47C07K16/18G01N33/57488
Inventor罗永章宋晓敏王晓峰卓巍常国栋付彦
OwnerTSINGHUA UNIV