Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes

A technology of molecular markers and bovine muscle, applied in biochemical equipment and methods, microbiological measurement/inspection, etc., can solve the problems of poor muscle fat deposition ability, poor breast development of cows, low milk production, etc., and achieve broad development The effect of prospect and profit margin, high precision and simple operation

Inactive Publication Date: 2014-04-23
NORTHWEST A & F UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Especially since the implementation of the "Provincial Standard" and "National Standard", the physique and appearance of Qinchuan cattle have changed significantly. There are also defects such as slow growth, poor muscle fat deposition ability, poor breast development of cows, and low milk production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes
  • Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes
  • Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] This example is used to illustrate the acquisition of whole blood genomic DNA of Qinchuan cattle.

[0027] (1) Thaw the frozen blood sample at room temperature, add about 3mL whole blood into a 7mL centrifuge tube, add an equal volume of PBS buffer, mix for 10min, centrifuge at 12000rpm for 5min, discard the supernatant, and repeat twice;

[0028] (2) Add 2mL STE, mix for 5-10min, and bathe in 37℃ water for 1h;

[0029] (3) Add proteinase K (20mg / mL) to a final concentration of 100μg / μL, and mix well;

[0030] (4) Add 70 μL of SDS, shake gently in a 56°C water bath, and digest overnight until viscous blood clots cannot be seen;

[0031] (5) Add an equal volume of Tris saturated phenol, cap the tube tightly, slowly mix it back and forth for at least 10 minutes, and centrifuge at 12000 rpm and 4°C for 10 minutes;

[0032] (6) Transfer the supernatant to a new sterilized centrifuge tube, and repeat the extraction once with Tris saturated phenol;

[0033] (7) Then add an...

Embodiment 2

[0040] This example is used to illustrate PCR-SSCP analysis.

[0041] Referring to the sequence of bovine THRSP gene provided in GeneBank (accession number: No. AY656814), primers were designed using Primer5.0 software. The primer sequences are as follows:

[0042] THRSP-F: 5'-3': CGCCTCCGATCTCTACAACT (SEQ ID No. 1)

[0043] THRSP-R: 5'-3': CCAGCTTCAGTCTCAGCTCC (SEQ ID No. 2)

[0044] The Qinchuan cattle whole blood genomic DNA obtained in Example 1 was used for PCR reaction using the above primers. The reaction conditions were 95°C, pre-denaturation for 5 min; 95°C, denaturation for 30 sec, 56.5°C, renaturation for 30 sec, 72°C extension for 30 sec, a total of 35 cycles; 72°C extension for 10 min.

[0045] After the reaction, the PCR reaction solution (5 μL) was taken for agarose gel electrophoresis to detect the PCR product.

[0046]Take 5 μL of the PCR product and mix it with 8 μL of loading buffer (deionized formamide with a volume fraction of 98%, bromophenol blue wit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes. The method comprises the steps of designing a pair of primers according to a cattle THRSP gene sequence, executing the SSCP (single strand conformation polymorphism) band type detection on Qinchuan cattle whole-blood genomic group DNA (deoxyribonucleic acid) after PCR proliferation, and determining the Qinchuan cattle meat tenderness and the water-holding capacity by analyzing the band type. By adopting the PCR-SSCP technology and analyzing and comparing the variation point gene type, the meat quality of the cattle can be predicted and determined; the molecular marking method is simple to operate, low in expense, high in precision and capable of realizing rapid detection.

Description

technical field [0001] The invention belongs to the field of animal molecular biology and genetic engineering, and relates to a molecular marker method for predicting Qinchuan beef muscle tenderness and water retention by using THRSP gene. Background technique [0002] Qinchuan cattle have the advantages of tall body, strong working ability, good meat performance, stable genetics, and good adaptability. Its origin can be traced back to the Neolithic Age from 8000 to 6000 BC, and its wild ancestor may be the short-horned Asian aurochs. The formation of Qinchuan cattle has an important relationship with the long-term feeding of alfalfa, which is known as the "king of grass". At present, the number of Qinchuan cattle and their improved cattle in the Guanzhong area of ​​Shaanxi is about 1.5 million, which plays an important role in promoting the development of local agricultural production and the prosperity of the rural economy. In recent years, the quantity and quality of Qi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor王洪宝昝林森张小白张莺莺
OwnerNORTHWEST A & F UNIV