Check patentability & draft patents in minutes with Patsnap Eureka AI!

TAT-IL-24-KDEL fusion protein as well as preparation method and application thereof

A technology of TAT-IL-24-KDEL and SUMO-TAT-IL-24-KDEL is applied in the field of TAT-IL-24-KDEL fusion protein and its preparation to achieve the effect of promoting apoptosis

Inactive Publication Date: 2014-04-30
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Aiming at the endoplasmic reticulum pathway of IL-24, the use of genetic engineering technology to prepare a large amount of IL-24 protein and use it to promote tumor cell apoptosis has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • TAT-IL-24-KDEL fusion protein as well as preparation method and application thereof
  • TAT-IL-24-KDEL fusion protein as well as preparation method and application thereof
  • TAT-IL-24-KDEL fusion protein as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Preparation of TAT-IL-24-KDEL fusion protein

[0041] 1. Construction of pET28a(+) / SUMO-TAT-IL-24-KDEL recombinant plasmid

[0042] a. Obtain the gene encoding the TAT-IL-24-KDEL fusion protein. Using the full-length IL-24 gene as a template, using the upstream primer containing the coding sequence of the TAT penetrating peptide and the downstream primer containing the coding sequence of the endoplasmic reticulum localization signal peptide KDEL, the TAT penetrating peptide and the endoplasmic reticulum were amplified by PCR. The gene encoding the positioning signal peptide KDEL was fused to the N-terminus and C-terminus of the IL-24 gene respectively to obtain the gene encoding the TAT-IL-24-KDEL fusion protein.

[0043] Upstream primer: 5'-CGCGGATCC TATGGCAGGAAGAAGCGTAGACAGAGAGACGTAGA GCCCAGGGCCAAGAGTTCC-3' (the underline indicates the TAT penetrating peptide coding sequence);

[0044] Downstream primer: 5'-CCGCTCGAGTCA GAGCTCGTCCTT GAGCTTGTAGAATTTCTGC-3' (the un...

Embodiment 2

[0060] Activity detection of TAT-IL-24-KDEL fusion protein

[0061] The pro-apoptotic effect and intracellular localization of TAT-IL-24-KDEL fusion protein on breast cancer MCF-7 cells were detected in vitro.

[0062] 1. The apoptosis-promoting effect of TAT-IL-24-KDEL fusion protein on breast cancer MCF-7 cells was detected by flow cytometry, and the specific operations were as follows:

[0063] 1.1. Digest monolayer cultured cells with 0.25% trypsin, prepare single cell suspension with DMEM medium containing 10% fetal bovine serum, and mix 10 6 Cells were inoculated into 60mm culture dishes and cultured in 37°C, 5% CO2 incubator for 24h.

[0064] 1.2. Dilute the fusion protein with serum-free DMEM medium to a solution with a final concentration of 5nM, 10nM and 20nM, add them to the culture dish respectively, and use PBS as a negative control.

[0065] 1.3 After 24 hours, digest with 0.125% trypsin without EDTA, add 3 mL of complete medium to make a single-cell suspension...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a TAT-IL-24-KDEL fusion protein which is a fusion protein of which TAT cell-penetrating peptide and endoplasmic reticulum positioning signal peptide KDEL are respectively connected with the N terminal and C terminal of interleukin-24(IL-24). The preparation steps comprises: performing PCR (Polymerase Chain Reaction) amplification to obtain a TAT-IL-24-KDEL encoding gene, by using pET28-SUMO as a carrier, converting BL21(DE3), and heterologously expressing the TAT-IL-24-KDEL fusion protein with SUMO label. Because the fusion protein is expressed in a mode of inclusion body, and a high-purity TAT-IL-24-KDEL fusion protein is obtained after the operations of renaturation, nickel column purification and label removing. The TAT-IL-24-KDEL fusion protein purified through flow cell experiment detection has apoptosis-promoting action to breast cancer MCF-7 cells, and the positioning condition of the fusion protein in the cells is detected by using immunofluorescence experiment detection. The invention firstly provides a preparation method of the TAT-IL-24-KDEL fusion protein; the purity reaches 92 percent; the TAT-IL-24-KDEL fusion protein can be effectively positioned on endoplasmic reticulum to promote the apoptosis of the breast cancer MCF-7 cells.

Description

technical field [0001] The invention relates to bioengineering, in particular to a TAT-IL-24-KDEL fusion protein and its preparation method and application. Background technique [0002] In 1995, Fisher P. B. discovered a new gene related to human melanoma differentiation by subtractive hybridization technology, called mda-7 at that time, and found that with the growth, development and metastasis of melanoma cells, the expression of mda-7 gradually decreased to the final The disappearance of MDA-7 confirmed that its expression product MDA-7 has the ability to inhibit the proliferation of melanoma cells and promote the terminal differentiation of melanoma cells. In 2002, Caudell et al. confirmed the cytokine properties of MDA-7 and renamed it human interleukin-24 (Human interleukin-24, hIL-24). So far, a large number of experiments have proved that IL-24 has the ability to selectively inhibit the growth of various tumors and induce the proliferation of tumor cells. Normal c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C07K1/22C12N15/62C12N15/70A61K38/20A61K47/48A61P35/00
CPCA61K38/00A61P35/00C07K14/54C07K2319/03C07K2319/04C07K2319/10
Inventor 孙爱友魏东芝张舰王晓娟白超刚徐瑞董玉国张星
Owner EAST CHINA UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More