Method for preparing and detecting quick detection kit of raccoon component in foods and feeds
A detection kit and kit technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve problems related to religious beliefs, endanger human health, damage consumers' interests, etc., and achieve high sensitivity and operation Simple, highly specific effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Make the real-time fluorescent PCR detection kit of raccoon dog composition according to the following formula, and reagent wherein comprises as follows:
[0043] (1) 2×PCR Master Mix
[0044]Contains 0.05 u / μL Taq DNA polymerase, reaction buffer, 4 mmol / L magnesium chloride, 0.4 mmol / L dNTP (dATP, dCTP, dGTP, dTTP);
[0045] The reaction buffer contains 20 mmol / L tris-hydrochloric acid at pH 8.8, 100 mmol / L potassium chloride and 2% Triton X-100;
[0046] (2) Upstream primer: 10 μmol / L, sequence: 5'- AATCTTGCCTGGGTTTGGAA -3';
[0047] (3) Downstream primer: 10 μmol / L, sequence: 5'- CAGTAAATATGTGGTGGGCTCACA -3';
[0048] (4) Taqman-MGB probe: 10 μmol / L, the sequence is: 5'- CATACTACTCCGGGAAAA -3'.
[0049] Follow the procedure below for testing:
[0050] (1) Extraction of DNA from non-raccoon samples
[0051] A. Weigh 0.1 g of sample and add it to a 2 mL centrifuge tube. Add 600 μL of preheated CTAB lysis buffer and 40 μL of proteinase K, mix gently, and incubate...
Embodiment 2
[0069] Make the real-time fluorescent PCR detection kit of raccoon dog composition according to the following formula, and reagent wherein comprises as follows:
[0070] (1) 2×PCR Master Mix
[0071] Contains 0.05 u / μL Taq DNA polymerase, reaction buffer, 4 mmol / L magnesium chloride, 0.4 mmol / L dNTP (dATP, dCTP, dGTP, dTTP);
[0072] The reaction buffer contains 20 mmol / L tris-hydrochloric acid at pH 8.8, 100 mmol / L potassium chloride and 2% Triton X-100;
[0073] (2) Upstream primer: 10 μmol / L, sequence: 5'- AATCTTGCCTGGGTTTGGAA -3';
[0074] (3) Downstream primer: 10 μmol / L, sequence: 5'- CAGTAAATATGTGGTGGGCTCACA -3';
[0075] (4) Taqman-MGB probe: 10 μmol / L, the sequence is: 5'- CATACTACTCCGGGAAAA -3'.
[0076] Follow the procedure below for testing:
[0077] (1) Extraction of DNA from raccoon samples with different contents
[0078] A. Add liquid nitrogen to raccoon meat and mutton, grind them into powder, weigh 0.1 g each, and add them to a 2 mL centrifuge tube....
Embodiment 3
[0098] Make the real-time fluorescent PCR detection kit of raccoon dog composition according to the following formula, and reagent wherein comprises as follows:
[0099] (1) 2×PCR Master Mix
[0100]Contains 0.05 u / μL Taq DNA polymerase, reaction buffer, 4 mmol / L magnesium chloride, 0.4 mmol / L dNTP (dATP, dCTP, dGTP, dTTP);
[0101] The reaction buffer contains 20 mmol / L tris-hydrochloric acid at pH 8.8, 100 mmol / L potassium chloride and 2% Triton X-100;
[0102] (2) Upstream primer: 10 μmol / L, sequence: 5'- AATCTTGCCTGGGTTTGGAA -3';
[0103] (3) Downstream primer: 10 μmol / L, sequence: 5'- CAGTAAATATGTGGTGGGCTCACA -3';
[0104] (4) Taqman-MGB probe: 10 μmol / L, the sequence is: 5'- CATACTACTCCGGGAAAA -3'.
[0105] Follow the procedure below for testing:
[0106] (1) Extraction of DNA from the meat roll sample to be tested
[0107] A. Weigh 0.3 g of meat roll sample and add it to a 2 mL centrifuge tube. Add 600 μL of preheated CTAB lysis buffer and 40 μL of proteinase K, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
