Transgenic constructs and their application in the preparation of epididymal head gene conditional knockout mouse model

A technology of transgenic and constructs, applied in the field of genetic engineering

Active Publication Date: 2016-10-26
ZHEJIANG K2 ONCOLOGY CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There is no transgenic mouse that specifically expresses Cre recombinase in the head of the epididymis, so there is an urgent need to screen and develop this tool mouse in the field

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic constructs and their application in the preparation of epididymal head gene conditional knockout mouse model
  • Transgenic constructs and their application in the preparation of epididymal head gene conditional knockout mouse model
  • Transgenic constructs and their application in the preparation of epididymal head gene conditional knockout mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0112] Construction of Lcn5(1.8)-Cre transgenic vector and in vitro activity verification

[0113] 1. The backbone vector used for the Cre recombinase transgene vector driven by a specific promoter in the head of the epididymis is a commercially available pUBC transgene vector

[0114] Firstly, the pUBC vector was transformed, and the 167bp UBC promoter sequence was cut with Mlu Ⅰ and Avr Ⅱ double restriction enzymes, and the Avr Ⅱ restriction site was replaced with Kpn Ⅰ.

[0115] Using the pBLCAT-5m-RABP plasmid (Lareyre, Thomas et al. 1999) as a template, through the primer pair: lcn5-pro-S: 5' ACGACGCGTCTACCTGGCCTCTCCTGCTCCT -3' (SEQ ID NO: 6) and lcn5-pro-A: 5' CGTGGTACCTGGGTTCAGCTCCCCACCAG 3' (SEQ ID NO: 7) for PCR reaction, the primer amplifies the 1.8 kb Lcn5(1.8)-Cre promoter sequence, the full length of the 1.8 kb sequence is shown in SEQ ID NO: 1. The PCR product and the pUBC transgene vector were digested with Mlu Ⅰ and Kpn Ⅰ restriction enzymes respectively, li...

Embodiment 2

[0121] Transgenic mouse construction and identification

[0122] 1. Use SgrD I and Fsp I restriction enzymes to linearize the Lcn5(1.8)-Cre transgenic vector prepared in Example 1, and prepare transgenic mice by prokaryotic microscopy. The background of the transgenic mice is C57BL / 6( Palmiter and Brinster 1985).

[0123] Rat tail DNA was extracted and passed through the primer pair

[0124] Tg-Cre-S:5' GCCTGCATTACCGGTCGATGC 3' (SEQ ID NO: 8) and

[0125] Tg-Cre-A:5' CAGGGTGTTATAAGCAATCCC 3' (SEQ ID NO: 9) was amplified by PCR to detect positive transgenic mice and establish a line.

[0126] image 3 The identification and line establishment of the first transgenic mice were shown. A total of 38 first founder mice were born by pronuclear microinjection technique, among which 11 transgenic positive mice were identified by PCR technology, and WT was wild-type mice.

Embodiment 3

[0128] RT-PCR and quantitative PCR to detect the temporal and spatial expression characteristics of Cre recombinase mRNA in transgenic mice

[0129] Different tissues of Lcn5(1.8)-Cre transgenic mice were taken, and total RNA was extracted by referring to the operation method of TRIzol reagent (LifeTechnologies, USA), and the RNA was reversed by ReverTra Ace-α (FSK-100, TOYOBO) reverse transcription kit recorded as cDNA. The tissue-specific expression of Cre recombinase mRNA was detected by Tg-Cre-S and Tg-Cre-A (sequence as above).

[0130] In addition, the primer pair Lcn5-CDS-S: 5'TCAGCGAAGTACAAGGTCACC 3' (SEQ ID NO: 10) and Lcn5-CDS-A: 5'CATTGTTGTCCAAGCTCCG (SEQ ID NO: 11) were used to detect the expression of endogenous Lcn5 gene as a sample positive control.

[0131] Design the PCR primer pair cre-S: 5'GACCAGGTTCGTTCACTCATGGA 3' (SEQ ID NO: 12) and cre-A: 5'AACATTCTCCCCACCGTCAGTACG 3' (SEQ ID NO: 13), and detect Cre recombinase mRNA in the head of the epididymis by quan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a transgenic construct and application of the same in preparation of an epididymis head gene conditional knockout mouse model. Specifically speaking, it is discovered by the inventor that an Lcn5 gene promoter sequence with a length of 1.8 kb can drive expression of an exogenous gene in head (especially middle-and-far-end specific) areas of epididymis of a mouse and an exogenous Cre gene expression vector driven by the promoter is thus constructed. The transgenic vector can drive specific expression of an exogenous Cre gene at the head of the epididymis of an animal and expression of other genes like CreERT2 recombinase. Usage of such a transgenic system for preparation of a transgenic mouse, a high genomic integration rate (greater than 25%) can be obtained, and expression of an exogenous gene in medium-and-far-end areas of epididymis heads can be accurately and highly efficiently driven. The invention further establishes an epididymis head specific area conditional gene knockout or overexpression technology platform.

Description

technical field [0001] The present invention belongs to the field of genetic engineering. Specifically, the present invention relates to a transgenic construct and its application in the preparation of a conditional gene knockout mouse model of the head of the epididymis, especially the establishment of a conditional gene knockout of a specific region of the head of the epididymis Deletion or overexpression technology platform. Background technique [0002] Transgenic technology is needed to introduce exogenous genes into animal bodies or in-depth study of gene functions. In particular, to explore the functions of genes in animal bodies or improve animal traits, establish new strains, etc., and to study the effects of genes in the epididymis on epididymis development or sperm maturation. Function requires the use of transgene overexpression or gene knockout techniques. On the one hand, these technologies require transgene targeting vectors; on the other hand, in order to co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/54C12N15/85C12N5/10A01K67/027
Inventor张永莲谢胜松黄行许徐娟
OwnerZHEJIANG K2 ONCOLOGY CO LTD