Transgenic constructs and their application in the preparation of epididymal head gene conditional knockout mouse model
A technology of transgenic and constructs, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0112] Construction of Lcn5(1.8)-Cre transgenic vector and in vitro activity verification
[0113] 1. The backbone vector used for the Cre recombinase transgene vector driven by a specific promoter in the head of the epididymis is a commercially available pUBC transgene vector
[0114] Firstly, the pUBC vector was transformed, and the 167bp UBC promoter sequence was cut with Mlu Ⅰ and Avr Ⅱ double restriction enzymes, and the Avr Ⅱ restriction site was replaced with Kpn Ⅰ.
[0115] Using the pBLCAT-5m-RABP plasmid (Lareyre, Thomas et al. 1999) as a template, through the primer pair: lcn5-pro-S: 5' ACGACGCGTCTACCTGGCCTCTCCTGCTCCT -3' (SEQ ID NO: 6) and lcn5-pro-A: 5' CGTGGTACCTGGGTTCAGCTCCCCACCAG 3' (SEQ ID NO: 7) for PCR reaction, the primer amplifies the 1.8 kb Lcn5(1.8)-Cre promoter sequence, the full length of the 1.8 kb sequence is shown in SEQ ID NO: 1. The PCR product and the pUBC transgene vector were digested with Mlu Ⅰ and Kpn Ⅰ restriction enzymes respectively, li...
Embodiment 2
[0121] Transgenic mouse construction and identification
[0122] 1. Use SgrD I and Fsp I restriction enzymes to linearize the Lcn5(1.8)-Cre transgenic vector prepared in Example 1, and prepare transgenic mice by prokaryotic microscopy. The background of the transgenic mice is C57BL / 6( Palmiter and Brinster 1985).
[0123] Rat tail DNA was extracted and passed through the primer pair
[0124] Tg-Cre-S:5' GCCTGCATTACCGGTCGATGC 3' (SEQ ID NO: 8) and
[0125] Tg-Cre-A:5' CAGGGTGTTATAAGCAATCCC 3' (SEQ ID NO: 9) was amplified by PCR to detect positive transgenic mice and establish a line.
[0126] image 3 The identification and line establishment of the first transgenic mice were shown. A total of 38 first founder mice were born by pronuclear microinjection technique, among which 11 transgenic positive mice were identified by PCR technology, and WT was wild-type mice.
Embodiment 3
[0128] RT-PCR and quantitative PCR to detect the temporal and spatial expression characteristics of Cre recombinase mRNA in transgenic mice
[0129] Different tissues of Lcn5(1.8)-Cre transgenic mice were taken, and total RNA was extracted by referring to the operation method of TRIzol reagent (LifeTechnologies, USA), and the RNA was reversed by ReverTra Ace-α (FSK-100, TOYOBO) reverse transcription kit recorded as cDNA. The tissue-specific expression of Cre recombinase mRNA was detected by Tg-Cre-S and Tg-Cre-A (sequence as above).
[0130] In addition, the primer pair Lcn5-CDS-S: 5'TCAGCGAAGTACAAGGTCACC 3' (SEQ ID NO: 10) and Lcn5-CDS-A: 5'CATTGTTGTCCAAGCTCCG (SEQ ID NO: 11) were used to detect the expression of endogenous Lcn5 gene as a sample positive control.
[0131] Design the PCR primer pair cre-S: 5'GACCAGGTTCGTTCACTCATGGA 3' (SEQ ID NO: 12) and cre-A: 5'AACATTCTCCCCACCGTCAGTACG 3' (SEQ ID NO: 13), and detect Cre recombinase mRNA in the head of the epididymis by quan...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com