Bacillus licheniformis strain loaded with serine acetyl transferase gene as well as building method and application thereof
A technology of Bacillus licheniformis and serine acetylation, which is applied in the field of engineering strains of Bacillus licheniformis, can solve the problems of low bacitracin production, easy deposition of cysteine, and bacterial contamination, so as to increase the production of bacitracin and improve growth metabolism Cycle, enhance the effect of cysteine expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach
[0028] The specific embodiment of the construction method of the Bacillus licheniformis strain carrying the serine acetyltransferase gene is as follows:
[0029] 1. The specific operation steps of step (1) are:
[0030] Using the designed primers, the total DNA of Bacillus licheniformis strain DW2 was used as a template to amplify by ordinary PCR cysE Gene fragment.
[0031] Wherein, in the reaction system of this common PCR, adopt cysE The primer sequence of the gene fragment is:
[0032] cysE-1 (ie upstream primer): GTGTTCTTTAAAATGCTGA,
[0033] cysE-2 (downstream primer): TCACAGCTCATCTTCCCTTTC;
[0034] The common PCR reaction system used is composed of: template (total DNA) 1ul, fastPfu enzyme 0.5ul, upstream and downstream primers 1ul, fastPfu enzyme buffer 5ul and ddH2O 17.5ul, total system: 25ul; common PCR reaction conditions used are: 95 ℃ 10min; 95℃ 45s; 58℃ 45s; 72℃ 30s; cycle number 30; 72℃ 10min.
[0035] 2. The specific operation steps of step (2) are:
...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com