Supercharge Your Innovation With Domain-Expert AI Agents!

Bacillus licheniformis strain loaded with serine acetyl transferase gene as well as building method and application thereof

A technology of Bacillus licheniformis and serine acetylation, which is applied in the field of engineering strains of Bacillus licheniformis, can solve the problems of low bacitracin production, easy deposition of cysteine, and bacterial contamination, so as to increase the production of bacitracin and improve growth metabolism Cycle, enhance the effect of cysteine ​​expression

Active Publication Date: 2014-06-18
LIFECOME BIOCHEM
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are many disadvantages in this way of increasing the yield of bacitracin by adding cysteine ​​as feed: (1) the yield of bacitracin is still low; (2) when the amount of cysteine ​​added is large, the It takes a certain amount of time to dissolve, and the incompletely dissolved cysteine ​​is easy to deposit and block the pipe opening of the fermenter; (3) Artificially adding cysteine ​​to the medium will disrupt the normal metabolism of the production strain and affect the growth of the strain (4) The amount of cysteine ​​added is determined by the number of bacteria in the fermenter, and the amount of bacteria in the fermenter increases rapidly, so it is difficult to determine the amount of cysteine ​​added

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus licheniformis strain loaded with serine acetyl transferase gene as well as building method and application thereof
  • Bacillus licheniformis strain loaded with serine acetyl transferase gene as well as building method and application thereof
  • Bacillus licheniformis strain loaded with serine acetyl transferase gene as well as building method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach

[0028] The specific embodiment of the construction method of the Bacillus licheniformis strain carrying the serine acetyltransferase gene is as follows:

[0029] 1. The specific operation steps of step (1) are:

[0030] Using the designed primers, the total DNA of Bacillus licheniformis strain DW2 was used as a template to amplify by ordinary PCR cysE Gene fragment.

[0031] Wherein, in the reaction system of this common PCR, adopt cysE The primer sequence of the gene fragment is:

[0032] cysE-1 (ie upstream primer): GTGTTCTTTAAAATGCTGA,

[0033] cysE-2 (downstream primer): TCACAGCTCATCTTCCCTTTC;

[0034] The common PCR reaction system used is composed of: template (total DNA) 1ul, fastPfu enzyme 0.5ul, upstream and downstream primers 1ul, fastPfu enzyme buffer 5ul and ddH2O 17.5ul, total system: 25ul; common PCR reaction conditions used are: 95 ℃ 10min; 95℃ 45s; 58℃ 45s; 72℃ 30s; cycle number 30; 72℃ 10min.

[0035] 2. The specific operation steps of step (2) are:

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a bacillus licheniformis strain DW2 (pHY300-cysE) loaded with a serine acetyl transferase gene capable of producing at high yield, wherein the strain is preserved at the Typical Culture Preservation Centre in China in Wuhan, the preservation number is CCTCCNO:M2013402, and the preservation date is September 10, 2013. Application of the bacillus licheniformis loaded with the serine acetyl transferase gene cysE in bacitracin comprises the following steps: A, activating the strain; B, fermenting seeds; and C producing and fermenting. By adopting the bacillus licheniformis strain, the yield of the bacillus licheniformis is improved by 7%.

Description

technical field [0001] The invention relates to a bacillus licheniformis engineering strain carrying a serine acetyltransferase gene. Background technique [0002] Bacitracin is a light yellow or off-white powder, odorless and bitter in taste. It is a polypeptide antibiotic composed of 10 amino acids and 12 amino acid residues, which can effectively inhibit Gram-positive pathogenic bacteria and some Gram-negative bacteria. Bacitracin has the advantages of almost no absorption in the intestine, rapid excretion, and no residue in the body, so it is widely added to feed. [0003] At present, bacitracin is mostly produced by microbial fermentation, and its main production strain is Bacillus licheniformis ( Bacillus licheniformis ) and Bacillus subtilis ( Bacillus subtilis ). During the fermentation process of bacitracin, the supply of amino acid substrates has an important impact on its yield, and a reasonable and sufficient supply of amino acids can increase the yield of ba...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/75C12P21/04C12R1/10
Inventor 陈守文祁高富罗文李俊辉楼丽君
Owner LIFECOME BIOCHEM
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More