Fluorescent quantitative PCR method for detecting interleukin 17 in pig intestinal tissue
A technology for interleukin and fluorescence quantification, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, recombinant DNA technology, etc. Detection effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Preparation of a standard curve containing IL-17 target gene
[0021] 1. Primer design and synthesis
[0022] First search the porcine IL-17 sequence (AB102693.1) from http: / / www.ncbi.nlm.nig.gov / GenBank, and then use Perlprimer software to design primers according to the porcine IL-17 mRNA conserved sequence (CDS region) and send them to Shanghai Synthesized by Yingjun Bioengineering Co., Ltd. Primers and template sequences are as follows:
[0023] Forward primer: 5'-CTGGAGAAAGTGATGGTGAC-3' (SEQ ID No.1);
[0024] Reverse primer: 5'-CCTGAAAGCCTAACTGATTTGG-3' (SEQ ID No.2);
[0025] Template (SEQ ID No.3):
[0026] 5'-CTGGAGAAAGTGATGGTGACAGTGGGCTGCACCTGTGTCACCCCCATCGTCCGCCATATTTCTAAGAGCTTCTAGTCTGACCCCTGCTCCCCAAATCAGTTAGGCTTTCAGG-3'.
[0027] 2. Collection of intestinal samples from differently treated piglets
[0028] In order to detect the effect of Lactobacillus casei Zhang on the expression level of intestinal IL-17 in piglets after adding Lactobacill...
Embodiment 2
[0040] Example 2 Detection of IL-17 Gene Expression in Sample Pig Intestinal Tissue
[0041] 1. Pig intestinal samples were prepared into cDNA according to the aforementioned method, and then PCR reaction was carried out simultaneously with the internal reference gene GAPDH, and finally according to the relative quantitative △△C T Methods To determine the relative expression of IL-17 gene in the samples.
[0042] The detection results of the relative expression of IL-17 transcripts in the ileum and colon tissues of 4 blank group (Control) and 4 probiotic group (Lc Zhang) piglets (using GAPDH as an internal reference gene) are as follows:
[0043]
[0044]
[0045] 2. The expression level of IL-17 in pig intestinal tract was detected by ELISA method and compared with the detection results of fluorescent quantitative PCR method.
[0046] Collect 10 mg of porcine intestinal tissue sample, and add 200 μl of phosphate buffer saline containing 5mM DTT, 1mMPMSF (i.e. PBS solut...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
