Supercharge Your Innovation With Domain-Expert AI Agents!

Method for detecting plasmids of polycyclic aromatic hydrocarbons in environment and application thereof

A polycyclic aromatic hydrocarbon and environmental detection technology, applied in the fields of molecular biology and environmental biology, can solve the problems of time-consuming, cumbersome process, and complicated sample processing, and achieve the effects of high efficiency, wide infection spectrum, and low immunogenicity

Active Publication Date: 2014-07-02
NANJING MEDICAL UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the detection methods of PAHs in the environment are mainly chemical and biological methods: the former such as spectrophotometry and chromatography, the equipment is large and expensive, the sample pretreatment is complicated, and unknown pollutants cannot be detected; the latter such as cell proliferation Experiments, etc., the process is cumbersome, time-consuming, and has high technical requirements for operators, and the above two methods cannot accurately express the human body effects of the environmental pollutants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting plasmids of polycyclic aromatic hydrocarbons in environment and application thereof
  • Method for detecting plasmids of polycyclic aromatic hydrocarbons in environment and application thereof
  • Method for detecting plasmids of polycyclic aromatic hydrocarbons in environment and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] 1. Preparation of overexpression lentiviral plasmid

[0052] Genomic DNA containing the AHR gene promoter (NM_001621-promoter) was extracted from normal human peripheral blood leukocytes, and human genomic DNA was extracted using the operation method of the Genomic DNA Purification Kit (Tiangen Biochemical, DP318). According to the known human AHR gene promoter sequence, primers at both ends were designed and synthesized: upstream primer: TGGTTAATTAAGGCACTACACTATACTGTATTC, see SEQ ID NO: 2; downstream primer: CGGGCTAGCAACAGAGCGTCGACGGGACTC, see SEQ ID NO: 3. Genomic DNA was used as a template to amplify by conventional PCR reaction, and the amplified product was recovered and purified with an agarose gel DNA recovery kit (Tiangen Biochemical, DP209-03).

[0053] Lentiviral expression vector CV060 (the sequence of elements is MCS-firefly-Luc-Tk-Renilla-Luc), purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd., passed PacI and NheI restriction endonucleases (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting plasmids of polycyclic aromatic hydrocarbons in an environment and an application thereof, and relates to the fields of molecular biology and environmental biotechnology. According to the method provided by the invention, by extracting the promoter of a humanized AHR (Aromatic Hydrocarbon Receptor) gene, using a CV060 plasmid including a firefly luciferase and renilla luciferase reporter gene as a carrier and inserting the AHR gene promoter with a specific sequence, a recombined lentivirus plasmid of a reference internal type dual-luciferase reporter gene including the AHR gene promoter is built. The detection method provided by the invention is good in repeatability, high in sensitivity, reliable in detection result, and simple and convenient to operate, and can be widely applied to the detection of the polycyclic aromatic hydrocarbons in the environment.

Description

Technical field: [0001] The present invention relates to the fields of molecular biology and environmental biotechnology, in particular to a method for constructing a recombinant plasmid containing a human-derived AHR gene promoter and a dual-luciferase reporter gene, thereby being applied to polycyclic aromatic hydrocarbons in the environment presence and content detection. Background technique: [0002] Polycyclic Aromatic Hydrocarbons (PAHs for short) refer to a class of hydrocarbons containing two or more benzene rings in their molecules, which mainly come from the cracking and incomplete combustion of organic matter such as coal, petroleum, and wood. There are about 200 known PAHs, which are widely distributed in the environment of human life. Environmental pollution caused by PAHs has attracted more and more attention, and it has become a priority monitoring substance in many countries. In 1976, EPA listed 16 PAHs as priority pollutants. In 1990, 7 of the 68 water p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12Q1/68
Inventor 顾爱华严丽锋吉贵祥赵鹏
Owner NANJING MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More