Method for detecting copper using copper ion-specific DNA and sybr Green I fluorescence method
A technology for ion detection and copper ions, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of complex catalytic reactions, instability, and high cost of DNAzyme synthesis, and achieve good selectivity, simple operation, and sensitivity high effect
Active Publication Date: 2016-07-06
SHANGHAI JIAOTONG UNIV
View PDF4 Cites 0 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
[0006] The present invention aims at defects in the prior art such as the need for fluorescent labeling of nucleic acids, the high and unstable synthesis of DNAzyme, and the involvement of complex catalytic reactions, etc., and proposes a copper ion-specific DNA and SYBRGreenI fluorescence method to detect copper method, by comparing the changes in fluorescence signals, the detection of copper ions can be realized
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0024] This example includes the following steps: 1) Preparation of a detection system formed by copper ion-specific DNA (Cu100): In a 2 mL graduated centrifuge tube, add 10 μL of Cu100 with a concentration of 1 μM (the sequence is 5'‐AGATTGCACTTACTATCTCGATGAAAGAAGTACCGGAGCGACGTTGGTTGTTCTGTAAAATTGAATAAGCTGGTATCTCCTATAGTGAGTCGTATTACC‐3') For the mother liquor, add deionized water to 446.5 μL, mix thoroughly, and then place the centrifuge tube at 25°C for later use.
[0025] 2) Prepare a detection system with known copper concentration: take 15 centrifuge tubes containing the mixed solution of the detection system formed by copper ion-specific DNA (Cu100) prepared by step 1), and add 50 μL of copper standard solutions of different concentrations respectively, so that The copper content in the entire detection system was maintained at 6-600ppb. After mixing thoroughly, the centrifuge tube was incubated at 25°C for 30 minutes, and 3.5 μL of 50×SG mother solution was added, and incu...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
The invention discloses a method for detecting copper by using a copper ion specificity DNA and an SYBR Green I fluorescence method. A standard copper ion detection system is prepared by a detection liquid containing a copper ion specificity DNA; a concentration-relative fluorescence intensity standard curve is prepared after detection of the fluorescence intensity by the detection liquid and a blank control liquid; finally, detection of the copper ion concentration is achieved by placing a to-be-tested water sample into the detection liquid containing the copper ion specificity DNA in detection, detecting the fluorescence intensity and comparing with a standard curve, so as to achieve detection of the copper ion concentration. Detection of the copper ion can be achieved by comparing the change of a fluorescence signal. The detection method provided by the invention is high in sensitivity, good in selectivity, simple and fast to operate, and independent on large-scale instruments and equipment, and can be applied to real-time in-situ detection of water copper, and the lowest detection limit is 5.57ppb.
Description
technical field [0001] The invention relates to a method in the technical field of water quality monitoring, in particular to a method for detecting copper by utilizing copper ion-specific DNA and SYBRGreenI fluorescence method. Background technique [0002] Copper ion is an important metal ion in the field of environmental monitoring and biology. Exposure of the human body to high concentrations of copper ions can cause various adverse health effects, such as stomach disease, intestinal disease, liver or kidney damage, Alzheimer's disease, individual Menkes, Wilson disease and prion disease. In view of this, the United States Environmental Protection Agency (EPA) set the maximum allowable value of copper ions in drinking water as 1.25ppm (about 20μM). Therefore, it is of great practical significance to establish a highly sensitive and highly selective copper ion detection method. [0003] Traditional copper ion detection methods include atomic absorption spectrometry, ato...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 周培詹深山徐涵楚詹学佳张暐霖吕晶
Owner SHANGHAI JIAOTONG UNIV