Chimeric chemokines receptors capable of making T cells tend to tumor locations

A tumor and factor technology, applied in the fields of molecular biology and immunology, can solve problems such as complex structures

Active Publication Date: 2014-08-06
SHANGHAI CELL THERAPY GRP CO LTD
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, like other chemokine receptors, due to its complex structure (seven transmembrane, including seven intramembrane regions), there is no report on the use of a certain domain of CXCR3 to direct T cells to chemotaxis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric chemokines receptors capable of making T cells tend to tumor locations
  • Chimeric chemokines receptors capable of making T cells tend to tumor locations
  • Chimeric chemokines receptors capable of making T cells tend to tumor locations

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1: Design, synthesis and construction of expression vector of vCCR expression cassette

[0065] According to the amino acid sequence and coding sequence of each component of vCCR, splicing into the entire fused amino acid sequence and coding DNA expression frame, wherein the peptides constituting vCCR include:

[0066] The amino acid residue sequence of the signal peptide is:

[0067] MEFWLSWVFLVAILKGVQC (SEQ ID NO: 1).

[0068] The signal peptide coding sequence is:

[0069] GAGTTTTGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGTCCAGTGT (SEQ ID NO: 2).

[0070] The amino acid residue sequence of Linker1 is:

[0071] GGGGGGGGG (SEQ ID NO: 3).

[0072] The coding sequence of Linker1 is:

[0073] GGTGGAGGTGGAGGTGGAGGTGGAGGT (SEQ ID NO: 4).

[0074] The amino acid residue sequence of Linker2 is:

[0075] GGGGSGGGGS (SEQ ID NO: 5).

[0076] The coding sequence of Linker2 is:

[0077] GGTGGCGGAGGCTCCGGAGGTGGAGGCTCT (SEQ ID NO: 6).

[0078] The amino acid residue ...

Embodiment 2

[0096] Example 2: Genetic modification of T cell lines

[0097] The high-quality plasmids of each recombinant expression vector constructed and purified in Example 1 were transfected into Jurkat (T lymphocyte cell line, purchased from Hong Kong University) by calcium phosphate transfection method. After 3 days, the transfected Jurkat cells were transferred to RPMI1640 medium with neomycin, and the cells were cloned by limiting dilution method. After 36 days of selection, Jurkat cell lines (Clone1, Clone2) with neomycin resistance and genetic modification of vCCR were established (see image 3 ).

[0098] Primers for synthetic PCR identification of the vCCR expression cassette:

[0099] Upstream primer 5'-TGGCTCTCCTCAAGCGTATT-3' (SEQ ID NO: 15),

[0100] Downstream primer 5'-TGCTCAGGTAGTGGTTGTCG-3' (SEQ ID NO: 16).

[0101] The predicted product size is 744bp.

[0102] Follow the instructions of the Biomed Cell Genomic DNA Rapid Extraction Kit (Cat. No.: DN0701) to extra...

Embodiment 3

[0103] Example 3: Flow cytometry detection of Jurkat cell lines genetically modified by vCCR (Clone1, Clone2) expression rate

[0104] Jurkat cells were treated without adding antibodies to adjust the voltage according to the method, Jurkat plus flow antibody PE was used as a control group, the sample group was the screened Clone1 plus flow antibody PE, and the screened Clone2 plus flow antibody PE; cell count, adjusted Concentration, take 10 6 -10 7 For each cell, wash once with 1×PBS; wash once with 1×PBS, centrifuge to remove supernatant, resuspend in 100 μl PBS; add 10 μg mouse IgG and incubate for 15 minutes; add 10 μl PE-conjugated anti-FLT1 reagent (purchased from R&D Company), ice Incubate for 30 minutes; wash the cells with 4ml 1×PBS each time, and wash twice; resuspend the cells in 1ml 1×PBS, ready for detection on the machine.

[0105]After the results of flow cytometry detection (see Figure 4), the screened cell lines Clone1 and Clone2 both expressed the targ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of molecular biology and immunology, and relates to chimeric chemokines receptors capable of making T cells tend to tumor locations. Specifically, the chimeric chemokines receptors are formed in a manner that a peptide fragment of a generated factor secreted by efficiently-combined tumor cells or tumor stromal cells is connected with a transmembrane region originated from a high-affinity receptor and a signal domain peptide fragment capable of making the T cells efficiently migrated through hinge structures. A membrane outer peptide fragment receives a corresponding factor signal and transfers the signal into cells, and a related path for promoting T cell chemotaxis is started through an intracellular region of the signal domain peptide fragment capable of promoting the migration of the T cells, so that the T cells modified by the chimeric chemokines receptors have a characteristic of migrating to the corresponding factor high concentration direction, and a normal tumor killing activity is not weaken, so as to ensure the tumor adoptive cell therapy effector T cells can efficiently reach the tumor nidus locations, and play a role in treatment.

Description

technical field [0001] The invention belongs to the fields of molecular biology and immunology, and relates to a chimeric chemokine receptor capable of making T cells approach tumor sites. The present invention also relates to the coding sequence and use of the chimeric chemokine receptor. Background technique [0002] Adoptive cell therapy (ACT) is a method to reinfuse processed autologous or allogeneic immune cells (mainly autologous cells) to tumor patients to enhance the patient's immune function and achieve therapeutic purposes. Currently, tumor ACT is developing rapidly, and has achieved very good results in the clinical treatment of various types of malignant tumors (Nature.2011;480:480-9; J Clin Oncol.2011;29:4828-36). [0003] However, adoptive cell therapy is usually given by intravenous infusion, and only a part of the cells can actually reach the tumor lesion and play a therapeutic role. [0004] The tumor microenvironment is composed of tumor cells and their s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/85C12N15/867C12N5/10A61K38/17A61K39/395A61K48/00A61P35/00
Inventor钱其军金华君朱洋洋丁娜王颖俞德超李林芳吴孟超
OwnerSHANGHAI CELL THERAPY GRP CO LTD