Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for fermenting and producing l-lysine with bacteria with weakened aconitase expression and/or reduced enzyme activity

A technology of bacterial fermentation and aconitase, which is applied in the field of amino acid fermentation, can solve the problems of long metabolic distance, difficult bacterial growth, and cannot be simply improved or knocked out, so as to achieve the effect of increasing production and facilitating popularization and application

Active Publication Date: 2019-03-19
INNER MONGOLIA EPPEN BIOTECH CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is known that in Escherichia, acnA The gene (its nucleotide sequence is shown in SEQ ID No: 1) encodes aconitase A, but it may be because its metabolism is too far away from the final l-lysine product, and the intermediate metabolic branches are too many and complicated, while Has not attracted attention in l-lysine fermentation
[0004] After long-term research and practice, especially with some luck, the inventor accidentally found that the transformation of acnA gene can help to improve l- The production of lysine; however, the prior art either introduces beneficial enzyme genes with increased expression and / or enzymatic activity by increasing copies and / or site-directed mutagenesis, or by knocking out unfavorable genes to make them enzymatically active and / or The expression level disappears, but the difference is that the inventors found that the acnA gene cannot be simply improved or knocked out, especially after knocking out, it makes bacterial growth difficult and difficult for practical application, so the developed A new method for acnA gene regulation to increase the production of L-lysine, and this method is compatible with the existing chromosomal modification sites of a large number of high-production L-lysine bacteria There is no conflict, and the effect of improvement can be superimposed, so that it can be practically used for bacterial fermentation to produce l-lysine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Build Example 1 Replace acnA The start codon ATG is GTG

[0033] wild-type Escherichia coli E. coli The genome chromosome of K12 W3110 strain (available from NITE Biological Resource Center (NBRC)) was used as a template, and PCR amplification was performed with primers P1 and P2, P3 and P4 respectively, and the lengths were 510 bp and two DNA fragments of 620 bp (named Up1 and Down1 fragments, respectively). Among them, PCR was carried out as follows: denaturation at 94°C for 30 s (seconds), annealing at 52°C for 30 s (seconds), and extension at 72°C for 30 s (seconds) (30 cycles). Wherein, the primer sequence is as follows:

[0034] P1:5'-CGC GGATCC GGAGTCGTCACCATTATGCC-3' (underlined Bam H I restriction site)

[0035] P2:5'-TCTCGTAGGGTTGACGACA C AGCTCCTCCTTAATGACAGG-3’ (underline indicates point mutation)

[0036] P3:5'-CCTGTCATTAAGGAGGAGCT G TGTCGTCAACCCTACGAGA-3' (underline indicates point mutation)

[0037] P4:5'-ATT GCGGCCGC TCCATTCACCGTCCTGCAAT-3...

Embodiment 2

[0041] Build Example 2 acnA Gene sequence mutation reduces aconitase activity

[0042] The 90 bp base before the stop codon was deleted to reduce the activity of aconitase. Specifically, the extracted wild-type E. coli E. coli K12 W3110 genome chromosome was used as a template, PCR amplification was performed with primers P5 and P6, P7 and P8 respectively, and two DNA fragments (Up3 and Down3 fragments) with lengths of 752 bp and 657 bp were obtained, respectively. Among them, PCR was carried out as follows: denaturation at 94°C for 30 s (seconds), annealing at 52°C for 30 s (seconds), and extension at 72°C for 30 s (seconds) (30 cycles). Wherein, the primer sequence is as follows:

[0043] P5:5'-CGC GGATCC CGTCACACGATCCGATACCT-3' (underlined Bam H I restriction site)

[0044] P6:5'- CGGCAAGCAAATAGTTGTTATACGACTTCCTGGCTACCAT -3' (underline indicates point mutation)

[0045] P7: 5'-ATGGTAGCCAGGAAGTCGTATAACAACTATTTGCTTGCCG-3' (underline indicates point mutation)

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for producing L-lysine through fermentation. The method comprises the following steps: modifying the bacteria to weaken but not vanish the expression of aconitase A and / or enzymatic activity, and producing L-lysine by using the modified bacteria through fermentation. In addition, the invention further provides a method and an application derived from the method, and polynucleotide, carriers and bacteria which can be applied to the methods and the application.

Description

technical field [0001] The present invention belongs to the field of amino acid fermentation, in particular, the present invention relates to the fermentative production method of l-lysine and its derivation method and application, and polynucleotides, vectors and bacteria that can be used in these methods and applications. Background technique [0002] Production of l-lysine by fermentation of l-lysine-producing bacteria (eg, Escherichia coli of the genus Escherichia and rod-shaped bacteria of the genus Corynebacterium) has been industrially applied. These bacteria can be bacteria isolated from nature, bacteria obtained through mutagenesis or genetic engineering, or both. In the current literature reports, the attention through genetic engineering is mainly focused on pnt, dap and ppc Isogenically, there is no focus on aconitase (eg, aconitase A) and its encoding gene for L-lysine production. [0003] Aconitase is an enzyme in the tricarboxylic acid cycle that catalyzes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12P13/08C12N15/61C12N15/70C12N1/21C12R1/19
Inventor 马吉银温廷益陈金龙梁勇刘树文魏爱英杨立鹏孟刚任瑞
Owner INNER MONGOLIA EPPEN BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com