GeXP quick detection kit and detection method for identifying 8 chicken immunosuppression disease pathogens
An immunosuppressive and pathogenic technology, applied in the biological field, can solve the problems of limited quantity, increased probability of dimerization of complex primers, multiplex PCR can not achieve high-throughput rapid detection and analysis, etc., to achieve strong specificity and high sensitivity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1, the design of PCR primer pair
[0034] Download the sequences of known primers from NCBI, use DNASTAR software for sequence comparison, select highly conserved and specific gene fragments for each target gene, design 8-fold specific primers by primer premier5. Add GeXP universal primers at the 'end, and the primer direction is from the 5' end to the 3' end, as follows:
[0035]1. The primer pair A of the target gene with chicken Marek's disease virus (MDV) meq gene:
[0036] MDV-F1: AGGTGACACTATAGAATAAGGGAGCAGACGTACTATGTAGACAA (sequence 1 in the sequence listing);
[0037] MDV-R1: GTACGACTCACTATAGGGATGGTAAGCAGTCCAAGGGTCA (sequence 2 in the sequence listing);
[0038] The expected length of the amplified product (ie, the target peak position) is 227bp.
[0039] 2. Primer pair B with the A subgroup avian leukemia virus (ALV-A) gp85 gene as the target gene:
[0040] ALV-A-F1: sequence 3 in the sequence listing of AGGTGACACTATAGAATACAAGGGGTTCCTTGGTATCT;
...
Embodiment 2
[0068] Embodiment 2, the specific detection of PCR primer pair
[0069] 1. Template preparation
[0070] 1. Viral RNA extraction and cDNA acquisition
[0071] Extract the RNA of the following sample viruses respectively: avian reovirus v-S1133, S1133, GuangxiR1, GuangxiR2, Guangxi110058 and Guangxi110116, chicken infectious anemia virus GXC060821 and infectious bursal disease virus NN1107 (to extract negative chicken embryo allantois The sample obtained from the solution was the negative control sample). cDNA was obtained by reverse transcription.
[0072] 2. Genomic DNA extraction
[0073] Total genomic DNA of chicken Marek's disease virus, proviral genomic DNA of subgroups A, B, and J avian leukosis virus, and avian reticuloendotheliosis virus were extracted from cell cultures of infected cells after aseptic treatment of diseased chicken tissues (A, B, and J subgroups of avian leukosis virus and avian reticuloendotheliosis virus are retroviruses, and the infection method...
Embodiment 3
[0143] Embodiment 3, the sensitivity detection of PCR primer pair
[0144] 1. Preparation of monoclonal plasmid standards containing target genes
[0145]Chicken Marek's disease virus, A, B and J subgroup avian leukosis virus, avian reticuloendotheliosis virus, avian reovirus, chicken infectious anemia virus and infectious The cDNA or DNA sample of bursal disease virus is template, chicken Marek's disease virus (MDV) meq gene obtained by PCR amplification, A subgroup avian leukemia virus (ALV-A) gp85 gene, B subgroup avian leukemia virus ( ALV-B) gp85 gene, avian leukemia virus subgroup J (ALV-J) gp85 gene, avian reticuloendotheliosis virus (REV) gp90 gene, avian reovirus (ReoV) S1 gene, chicken infectious anemia The full-length cDNA or DNA fragments of the virus (CIAV) VP1 gene and the infectious bursal disease virus (IBDV) VP5 gene were respectively connected with the plasmid pMD18-T vector to obtain 8 recombinant plasmids PA, PB, PC, PD, PE, PF, PG and PH, it was confirme...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 