Tegillarca granosa galactose lectin Tg-GAL and application thereof
A technology of galectin and galactose, which is applied in the field of functional gene screening, can solve the problems that the research on shellfish lectin has just started, and achieve the effect of broad-spectrum bactericidal activity and strong bactericidal effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0011] 1. Extraction and inversion of RNA from cockle blood cells
[0012] Take fresh cockles, use a needle to extract the blood in the cockle sinuses, take 1ml of blood and put it into a centrifuge tube, centrifuge at 3500 rpm for one minute, remove the supernatant, keep the blood cells, and extract RNA with Trizol reagent. The relative absorbance of A280 and A260 was detected by ultraviolet spectrophotometer, and the integrity of RNA was checked by electrophoresis. The RNA was reversed with the M-MLV Reverse Transcriptase Kit to obtain the first strand of cDNA.
[0013] 2. Subcloning and verification of ORF-containing cDNA of clam galectin (Tg-GAL)
[0014] Design of primers based on cDNA sequence of mature peptide of Tg-GAL gene
[0015] Tg-GAL-ORF-F5'TTGTTAAAATAGAGACAAGATG3'
[0016] Tg-GAL-ORF-R5'TAAAACAAAAGATTTTCAGAAG3'
[0017] To obtain the gene fragment encoding the mature peptide of the gene. PCR reaction program: denaturation at 94°C for 4 min, 1 cycle; denatur...
PUM
Property | Measurement | Unit |
---|---|---|
purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com