A method for detecting silver nanoparticles by fluorescence method based on g-tetramer
A technology of nano-silver particles and tetramers, applied in fluorescence/phosphorescence, material excitation analysis, etc., can solve the problem of distinguishing or detecting the total amount of nano-silver particles, and achieve stable and accurate results, great application prospects, and simple synthesis. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] A kind of method based on the fluorescence method of G tetramer to detect nano-silver particle, comprises the steps:
[0028] (1) Configure the sample solution to be tested: add 2.5 μL of 100 μM phosphoric acid and 5.7 μL of 88 mM hydrogen peroxide to the nano-silver aqueous solution. After adding, the total volume of the solution is 250 μL, so that H 3 PO 4 and H 2 o 2 The final concentrations were 1 μM and 2 mM respectively, and after mixing, react at room temperature for 30 min to obtain the sample solution to be detected;
[0029] (2) Configure multiple standard solutions: configure seven silver nitrate solutions with concentrations of 0.5, 1, 2, 4, 6, 8, and 10 μM respectively as seven standard solutions to draw a standard curve;
[0030] (3) Take eight 2 μL 100 μM single-stranded DNA (G-DNA) solutions containing G base repeat sequence, the G-DNA sequence is TGGGTAGGGCGGGTTGGGAAA, respectively add to eight 248 μL 20mM Tris-Ac, 2mM EDTA, pH 8.0 solution, heated ...
Embodiment 2
[0035] A kind of method based on the fluorescence method of G tetramer to detect nano-silver particle, comprises the steps:
[0036] (1) Configure the sample solution to be tested: add 10 μL of 100 μM phosphoric acid and 20 μL of 100 mM hydrogen peroxide to the nano-silver aqueous solution. 3 PO 4 and H 2 o 2 The final concentrations are 1μM and 2mM respectively, and after mixing, react at room temperature for 30min to obtain the sample solution to be detected;
[0037] (2) Configure multiple standard solutions: configure seven silver nitrate solutions with concentrations of 0.5, 1, 2, 4, 6, 8, and 10 μM respectively as seven standard solutions to draw a standard curve;
[0038](3) Take eight 8 μL 100 μM single-stranded DNA (G-DNA) solutions containing G base repeat sequence, the G-DNA sequence is TGGGTAGGGCGGGTTGGGAAA, and add them to eight 992 μL 20mM Tris-Ac, 2mM EDTA, pH 8.0 solution, heated at 90°C for 5 minutes to denature, mixed with equal volumes of sample solution...
PUM
| Property | Measurement | Unit |
|---|---|---|
| particle diameter | aaaaa | aaaaa |
| wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 