Unlock instant, AI-driven research and patent intelligence for your innovation.

Dual-luciferase monitoring plasmid for detecting living yeast cell UPR level, construction and application thereof

A dual-luciferase and yeast cell technology, which is applied in the field of dual-luciferase monitoring plasmids and its construction and application, can solve the unavoidable interference of marker protein folding, the inability to detect high-throughput living cells, and the low accuracy of plasma determination, etc. problem, to achieve the effect of shortening the detection cycle, short detection cycle and cumbersome operation

Inactive Publication Date: 2014-11-26
DONGHUA UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] 1. RT-PCR or Northern-blot experiment cycle is long and the sensitivity is low;
[0007] 2. When detecting UPRE or IP, it is difficult to avoid interference with the folding of the marked protein after the protein folding is inhibited;
[0008] 3. Existing Ca 2+ The plasma measurement accuracy is not high, and the experiment cost is high and the experiment cycle is long;
[0009] 4. Quantification needs to be carried out with the help of internal reference, and high-throughput detection of living cells cannot be performed;

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dual-luciferase monitoring plasmid for detecting living yeast cell UPR level, construction and application thereof
  • Dual-luciferase monitoring plasmid for detecting living yeast cell UPR level, construction and application thereof
  • Dual-luciferase monitoring plasmid for detecting living yeast cell UPR level, construction and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Construction of UPR detection plasmid pUST-08

[0056] Using conventional gene cloning techniques, the operable promoter Gal10p, luciferase reporter gene Rluc, HAC1 promoter 5'UTR sequence Hac1p, HAC1 intron Hac1i and its 3'UTR sequence, and luciferase reporter gene Fluc were cloned into yeast in sequence. In the low copy shuttle plasmid YCplac33 (such as figure 2 shown).

[0057] 1. Design primers

[0058] Gal10p-F: ACGCCAAGCTTGATCAAAAATCATCGCTTCG;

[0059] Gal10p-R: GCTCTAGACTCGACTCAAAAATTCTTAC;

[0060] Rluc‐Hac1p‐F: GCTCTAGAGTCCACCAATGACTTCGAAA;

[0061] Rluc‐Hac1p‐R: CGGGATCCTAGGTGGGGGAGGAGGAGGTTCGACATTTGTTCATTTTTGAG;

[0062] Hac1i‐F: GGGGTACCTATAGCGGGAAACAGTCTAC;

[0063] Hac1i‐R: CCACCAACAGCGATAATAAC;

[0064] Fluc‐F: TCAAAAATGAACAAATGTCG;

[0065] Fluc‐R: GGGGTACCATGACTCGAGCACGTGTTAC.

[0066] 2. Using plasmid YEP51-LIPIN1 as template, Gal10p‐F and Gal10p‐R as amplification primers (Gal10p‐F: ACGCCAAGCTTGATCAAAAATCATCGCTTCG; Gal10p‐R: GCTCTAGACTCGACTC...

Embodiment 2

[0080] Detecting Alternative Splicing of HAC1mRNA Using UPR Routine Detection Technology RT-PCR

[0081] Using conventional RT-PCR technology to detect the splicing rate of HAC1mRNA in wild-type yeast treated with 0.5 μg / mL tunicamycin, 2 μg / mL tunicamycin, 0.1 mM DTT, and 0.5 mM DTT

[0082] 1. Preferably use primers

[0083] ACT1-F:GCTTTGTTCCATCCTTCTG, as shown in SEQ ID NO:9;

[0084] ACT1-R:GAAACACTTGTGGTGAACG, as shown in SEQ ID NO:10;

[0085] HAC1-F: AGGAAAAGGAACAGCGAAGG, as shown in SEQ ID NO: 11;

[0086] HAC1-R:GAATTCAAACCTGACTGCGC, as shown in SEQ ID NO:12.

[0087] 2. According to the conventional RT-PCR technique to detect the splicing rate of HAC1, the steps are as follows: (1) clone the wild-type yeast BY4741a, pick it into 3mL SC-URA liquid medium as the seed fungus, and culture it overnight at 30°C and 180rpm; (2) ) the next day, the above seed bacteria were respectively transferred to fresh 6mL SC-URA liquid medium to ensure that the initial bacterial con...

Embodiment 3

[0090] Confirmation that hac1Δ and ire1Δ are ultra-sensitive UPR strains

[0091] IRE1-mediated activation of HAC1 mRNA splicing is one of the important pathways of UPR. The synthesized HAC1 can improve the protein folding ability of endoplasmic reticulum by activating the expression of downstream UPR-related genes to relieve endoplasmic reticulum stress. The deficiency of HAC1 or IRE1 will lead to the failure of the endoplasmic reticulum stress rescue mechanism of IRE1 / HAC1 in response to environmental stress, and aggravate the accumulation of unfolded proteins in the endoplasmic reticulum. To confirm this argument, HAC1 and IRE1 deletion mutants were tested for sensitivity to UPR-inducing drugs.

[0092] 1. Pick the strains to be tested (BY4741a, hac1Δ, ire1Δ) into 3mL SC liquid medium as seed bacteria, and culture overnight at 30°C and 180rpm.

[0093] 2. Take about 1×10 7 of yeast cells (OD 600 ≈1), after 10-fold serial dilution (dilution of 5 gradients), take 5ul of th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a dual-luciferase monitoring plasmid for detecting living yeast cell UPR level, a construction and an application thereof. plasmid is pUST-08 plasmid, a gene cloning technology is used, Gal10p, Rluc-Hac1p, Hac1i and Fluc are cloned to plasmid YCplac33 in order, and a Gal10p-Rluc-Hac1p-Hac1i-Fluc-HAC1i UPR detection dual-luciferase reporting element can be composed. The system can be used for detecting the living yeast cell UPR level. The dual-luciferase monitoring plasmid has the advantages of short detection period, high sensitivity, simple experimental operation and low cost.

Description

technical field [0001] The invention belongs to the field of cell UPR detection plasmid and its construction and application, in particular to a dual luciferase monitoring plasmid for detecting the UPR level of living yeast cells and its construction and application. Background technique [0002] An endoplasmic reticulum stress mechanism exists widely in eukaryotic yeast and even higher mammalian cells when large amounts of unfolded proteins or misfolded proteins accumulate excessively in the endoplasmic reticulum, the most prominent of which is the unfolded protein response (UPR), UPR stimulates a variety of regulatory factors including IRE1, and uses the endonuclease activity of IRE1 to recognize and cut the intron sequence at the 3' end of HAC1, so that Hac1i loses its translational inhibition effect on HAC1 and increases the expression of HAC1 Level, and then increase the expression of molecular chaperones related to downstream protein folding, so as to reduce the excess...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12Q1/68C12Q1/66C12Q1/02
Inventor 黄志伟房志家匡鑫杜秀秀刘伟伟肖君华
Owner DONGHUA UNIV