Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Beech ssr2 marker, primer pair, preparation method and application thereof

A primer pair and beech technology, which can be used in biochemical equipment and methods, DNA preparation, microbial measurement/inspection, etc., can solve problems such as poor stability

Inactive Publication Date: 2017-12-05
CENTRAL SOUTH UNIVERSITY OF FORESTRY AND TECHNOLOGY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although scholars at home and abroad have used ISSR, RAPD and other markers to study the genetic diversity of beech populations, both ISSR and RAPD markers are dominant markers with poor stability and cannot be directly applied to molecular marker-assisted breeding and QTL mapping

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Beech ssr2 marker, primer pair, preparation method and application thereof
  • Beech ssr2 marker, primer pair, preparation method and application thereof
  • Beech ssr2 marker, primer pair, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0029] Extraction and enzyme digestion of total DNA from beech

[0030] Select young beech leaves and extract the nuclear genome by CTAB method; use EcoRV to digest at 37°C for 3 hours, and inactivate the endonuclease at 65°C for 20 minutes; the reaction system is 20 μL, including 2.0 μL of 10×Buffer, 1.0 μL of EcoRV endonuclease, 2 μL of DNA, 15.0 μL of sterilized double distilled water;

[0031] Connection of connector

[0032] Connect the beech genomic DNA digested with EcoRV in step to the upper and lower linkers (upper linker sequence GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT, sequence listing SEQ.ID.No.4; lower linker sequence ACCAGCCC-NH2, sequence listing SEQ.ID.No.5); The 60 μL ligation system contains 9 μL enzyme-digested beech genomic DNA, 100 pmol of the upper and lower adapters; the ligation reaction is carried out under the condition of 1 times T4 ligase buffer, and ligated overnight at 16°C; the ligated mixture is reacted at 65°C for 20 minutes to inac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a beech SSR2 marker, a primer pair, its preparation method and application. The inventor uses a specific primer pair JS2 to perform PCR amplification on the beech total DNA to obtain a simple repeat sequence SSR2 marker. The method is simple and easy to operate, and the obtained simple repeat sequence has high polymorphism detected in the population and between populations of three natural populations of beech. The beech SSR2 marker is a co-dominant marker. Compared with other molecular markers, the SSR marker has good repeatability and high reliability. It can be applied to the evaluation of genetic diversity of beech, the construction of beech genetic map, and the spatial distribution of genetic variation in beech populations. The research on pattern and origin and evolution of beech, as well as the calibration of target genes, can also be applied to molecular marker-assisted breeding and QTL research of beech.

Description

technical field [0001] The invention belongs to the technical field of molecular markers in biological sciences, and in particular relates to a beech SSR2 marker, a pair of primers and a preparation method and application thereof. Background technique [0002] Zelkova schneideriana Hand.-Mazz. is a large deciduous tree belonging to the genus Zelkova in the family Ulmaceae, endemic to my country. Beech trees are distributed in the Huaihe River Basin in my country and the middle and lower reaches of the Yangtze River south of the Qinling Mountains. Beech wood is dense and hard, with bright color, beautiful texture and strong corrosion resistance. It is the first-class wood for the production of various high-end furniture and handicrafts. At the same time, because of its beautiful tree shape, large canopy, and rich seasonal changes in leaf color, it is also a popular traditional color-leaf garden landscape tree species. Due to the low germination rate of beech seeds, the diff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor 张日清汪灵丹金晓玲刘海龙
Owner CENTRAL SOUTH UNIVERSITY OF FORESTRY AND TECHNOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com