Application of hydrogen ion transport inorganic pyrophosphatase gene expression difference on salt tolerance of tomatoes

A salt-tolerant, tomato-based technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., to save time and manpower, speed up pace, and reduce workload

Inactive Publication Date: 2015-03-25
TIANJIN CITY AGRI BIO TECH RES CENT
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Its purpose is to distinguish tomato genotypes with different salt tolerance from the genetic level in view of the fact that no reliable and efficient identification method for tomato salt tolerance has been found so far, so as to provide a basis for cultivating new varieties of tomato and other plants with improved stress resistance. Proven detection method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of hydrogen ion transport inorganic pyrophosphatase gene expression difference on salt tolerance of tomatoes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] 1. The salt-tolerant tomato LA2711 and the non-salt-tolerant Tianjin local variety Jinfen 544 5-6-leaf tomato seedlings were used as materials, and the first mature leaf of the tomato plant was taken (counted from top to bottom). The detached leaves were rinsed three times with distilled water and once with deionized water. The leaves were cut into 1×2 cm rectangles with scissors, then rinsed three times with deionized water, and dried with absorbent paper. After detached leaves were stressed in 5% (w / w) sodium chloride solution for 0, 2, 4, and 6 minutes, total RNA was extracted from leaves and detected by 1% agarose gel electrophoresis.

[0041] 2. The Transcript First-Strand cDNA Synthesis SuperMix of Beijing Quanshijin Biotechnology Co., Ltd. was used for reverse transcription, and the obtained cDNA solution was used for the next step of PCR amplification.

[0042] 3. Real-time PCR

[0043] Primer design:

[0044] H + -PPase Forwoard: aatgaagagtgttggaagtgc...

Embodiment 2

[0054] Adopt specific primer to carry out the method for tomato salt tolerance determination, it is characterized in that carry out according to following steps:

[0055] (1) Take tomato seedlings with 5-6 leaves as the material, and take the first mature leaf of the tomato plant, which refers to the first mature leaf counted from top to bottom. Rinse the detached leaves three times with distilled water and once with deionized water, cut the leaves into a rectangle with a size of 1 × 2 cm with scissors, then rinse with deionized water for three times, and absorb the water with absorbent paper;

[0056] (2) Select chemically pure NaCl, 5% (w / w), and process for 2 minutes to extract total RNA from leaves;

[0057] (3) The obtained cDNA solution is used for the next step of PCR amplification;

[0058] (4) Real-time PCR

[0059] Primer design:

[0060] H + -PPase Forwoard: aatgaagagtgttggaagtgct gct

[0061] Reverse: cac gcacggtggt cttctcttca

[0062] Real-tim...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of hydrogen ion transport inorganic pyrophosphatase gene expression difference on salt tolerance of tomatoes. The application method comprises the following steps: taking 5-6 tomato seedlings as materials, and taking the first mature leaf of each tomato plant; washing the detached leaves three times by using distilled water, washing once by using deionized water, shearing the leaves to be rectangles by using a shear, washing three times by using deionized water, and absorbing the moisture by using absorbent paper; and selecting chemically pure 5 percent of NaCl, and treating for 6 minutes. The RNA of the detached leaves subjected to salt stress within 2 minutes is extracted, the gene expression amount of tomato genotype H+-PPase with high salt tolerance is enhanced by virtue of real-time quantitative PCR, and the expression amount of the tomato genotype with low salt tolerance is extremely small. According to the gene expression difference of H+-PPase, the salt tolerance of tomatoes is compared. According to the method, the salt tolerance potential is indicated on the gene level, and the method has important theoretical and practical significances on cultivation tomatoes of which the stress resistance is improved and other new varieties of plants.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to hydrogen ion transport inorganic pyrophosphatase (H + -PPase) group [0002] Application of expression differences in tomato salt tolerance. More specifically a method using H + - A detection method for detecting tomato salt tolerance by differential expression of PPase gene. Background technique [0003] With the development of human society, people continue to develop and utilize land, resulting in the increasing degree of secondary salinization of soil. As one of the main vegetable crops, the research on the salt tolerance of tomato has attracted people's attention, and the related research has been gradually carried out and deepened. However, because the parameters and indicators involved include morphology, biomass, physiological and biochemical aspects, and the identification period is also different, there is no unified method and standard for the identification of tomato sal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/6895C12Q2600/13C12Q2600/158C12Q2561/113
Inventor 郏艳红王姝宋建吉利柱
Owner TIANJIN CITY AGRI BIO TECH RES CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap