Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for precisely identifying Changfeng carps

A Changfeng crucian carp, precise technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problem that Changfeng crucian carp cannot be accurately distinguished, and achieve the effect of reliable method and strong stability

Inactive Publication Date: 2015-03-25
YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a method for accurately identifying Changfeng crucian carp, which is simple, accurate, reliable, and stable, and solves the problem that Changfeng crucian carp cannot be accurately distinguished from other crucian carp

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for precisely identifying Changfeng carps
  • Method for precisely identifying Changfeng carps
  • Method for precisely identifying Changfeng carps

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] A method for accurately identifying Changfeng crucian carp, comprising the following steps:

[0027] Identification of mitochondrial NADH4 gene in Changfeng crucian carp:

[0028] (1) Use TIANGEN Genomic DNA Extraction Kit to extract Changfeng crucian carp DNA, and perform PCR reaction:

[0029] The primers are: F: CCTCCTAATTGCCTCCATCA; R: CCCATGTGACTTACGGATGA.

[0030] PCR reaction system

[0031]

[0032] The PCR reaction process is: pre-denaturation at 94°C for 5 minutes, 35 cycles (denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, extension at 72°C for 1 minute)

[0033] (2) Amplified product connection:

[0034] Add reagents:

[0035]

[0036] React at 16°C for 30min

[0037] The whole amount was added to commercially purchased competent cells (Takara Company), and placed in ice for 30 min.

[0038] After heating at 42°C for 45s, place in ice for 1min.

[0039] Add 800 μl LB liquid medium without Amp, shake at 50 rpm / min for 45 min at ...

Embodiment 2

[0051]A method for accurately identifying Changfeng crucian carp, comprising the following steps:

[0052] Ploidy identification by flow cytometry:

[0053] (1) Blood sample preparation

[0054] Sample to be tested: venous blood of Changfeng crucian carp; control: venous blood of chicken blood, venous blood of heterogeneous gibel crucian carp.

[0055] (2) Sample staining

[0056] The fixed erythrocytes were mixed and filtered with a 300-mesh filter membrane. After filtration, the cells were washed twice with the buffer solution in the Cycle TEST PLUS DNA Reagent kit (BD Company, USA), centrifuged at 1000r / min for 5min, and the supernatant was discarded.

[0057] Adjust the cell concentration to 1×10 with buffer solution 6 cells / ml, take 100 μL of the cell suspension at this concentration, and add 250 μL of liquid A (punching agent) in 250 μL of Cycle TEST PLUS DNA Reagent kit. After mixing by slight oscillating, react at room temperature for 10 minutes. Add 200 μL of sol...

Embodiment 3

[0067] A method for accurately identifying Changfeng crucian carp, comprising utilizing PCR to amplify its mitochondrial NADH4 and further using flow cytometry to identify the ploidy of the sample (see Example 1 and Example 2 for specific methods), and the PCR primers are: F: CCTCCTAATTGCCTCCATCA; R: CCCATGTGACTTACGGATGA.

[0068] Utilize the method for above-mentioned PCR to detect the mixed population of 50 Changfeng crucian carp and 50 heterogeneous gibel crucian carp, detect altogether 50 samples that meet the identification standard of Changfeng crucian carp (that is, the DNA fragments amplified from 50 samples and SEQ ID NO .1 The similarity of the sequence shown in .1 is greater than or equal to 99%). The ploidy of the 50 samples screened out was further detected by flow cytometry. These 50 samples were all tetraploid, and the identification accuracy was 100%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for precisely identifying Changfeng carps. The method comprises the following steps: comparing the similarity between 110-866 site sequence information with a carp chondriogen sequence in a carp mitochondria NADH4 gene, or identifying chromosome ploidy through flow cytometry, or combining the two so as to quickly and precisely distinguish the Changfeng carps from other carp populations. The method can be used for providing accurate identification basis for identifying variety and germplasm of Changfeng carps as well as disputes produced in commercial aquaculture.

Description

technical field [0001] The invention belongs to the field of biotechnology for identifying fish species, and in particular relates to a method for accurately identifying Changfeng crucian carp. Background technique [0002] Gibel crucian carp is an important species of aquaculture species in my country. There are heterogeneous gibel crucian carp, Founder gibel crucian carp, Changfeng gibel crucian carp and many local species of gibel crucian carp used in production. The species of gibel carp in production are relatively mixed, and the morphology of all kinds of cultured gibel carp conforms to the national standard of gibel carp (GB 16874-2006). It is invalid to distinguish Changfeng crucian carp from other crucian carp only by morphology. Therefore, it is necessary to invent a method for accurately identifying Changfeng crucian carp and various cultured populations, which can better protect Changfeng crucian carp germplasm resources and solve various commercial disputes in a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6888C12Q2600/156
Inventor 李忠梁宏伟邹桂伟罗相忠
Owner YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI