Method for precisely identifying Changfeng carps
A Changfeng crucian carp, precise technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problem that Changfeng crucian carp cannot be accurately distinguished, and achieve the effect of reliable method and strong stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] A method for accurately identifying Changfeng crucian carp, comprising the following steps:
[0027] Identification of mitochondrial NADH4 gene in Changfeng crucian carp:
[0028] (1) Use TIANGEN Genomic DNA Extraction Kit to extract Changfeng crucian carp DNA, and perform PCR reaction:
[0029] The primers are: F: CCTCCTAATTGCCTCCATCA; R: CCCATGTGACTTACGGATGA.
[0030] PCR reaction system
[0031]
[0032] The PCR reaction process is: pre-denaturation at 94°C for 5 minutes, 35 cycles (denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, extension at 72°C for 1 minute)
[0033] (2) Amplified product connection:
[0034] Add reagents:
[0035]
[0036] React at 16°C for 30min
[0037] The whole amount was added to commercially purchased competent cells (Takara Company), and placed in ice for 30 min.
[0038] After heating at 42°C for 45s, place in ice for 1min.
[0039] Add 800 μl LB liquid medium without Amp, shake at 50 rpm / min for 45 min at ...
Embodiment 2
[0051]A method for accurately identifying Changfeng crucian carp, comprising the following steps:
[0052] Ploidy identification by flow cytometry:
[0053] (1) Blood sample preparation
[0054] Sample to be tested: venous blood of Changfeng crucian carp; control: venous blood of chicken blood, venous blood of heterogeneous gibel crucian carp.
[0055] (2) Sample staining
[0056] The fixed erythrocytes were mixed and filtered with a 300-mesh filter membrane. After filtration, the cells were washed twice with the buffer solution in the Cycle TEST PLUS DNA Reagent kit (BD Company, USA), centrifuged at 1000r / min for 5min, and the supernatant was discarded.
[0057] Adjust the cell concentration to 1×10 with buffer solution 6 cells / ml, take 100 μL of the cell suspension at this concentration, and add 250 μL of liquid A (punching agent) in 250 μL of Cycle TEST PLUS DNA Reagent kit. After mixing by slight oscillating, react at room temperature for 10 minutes. Add 200 μL of sol...
Embodiment 3
[0067] A method for accurately identifying Changfeng crucian carp, comprising utilizing PCR to amplify its mitochondrial NADH4 and further using flow cytometry to identify the ploidy of the sample (see Example 1 and Example 2 for specific methods), and the PCR primers are: F: CCTCCTAATTGCCTCCATCA; R: CCCATGTGACTTACGGATGA.
[0068] Utilize the method for above-mentioned PCR to detect the mixed population of 50 Changfeng crucian carp and 50 heterogeneous gibel crucian carp, detect altogether 50 samples that meet the identification standard of Changfeng crucian carp (that is, the DNA fragments amplified from 50 samples and SEQ ID NO .1 The similarity of the sequence shown in .1 is greater than or equal to 99%). The ploidy of the 50 samples screened out was further detected by flow cytometry. These 50 samples were all tetraploid, and the identification accuracy was 100%.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More