RT-HDA primer, kit and method for detecting tomato spotted wilt virus
A technology of tomato spotted wilt virus and kit is applied in the field of RT-HDA primers to achieve the effects of improving accuracy, high sensitivity and not easy non-specific amplification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Embodiment 1 specificity experiment
[0041] (1) Primer design
[0042] The present invention is based on the N gene full-length sequence of TSWV in the NCBI nucleic acid sequence database ( KC294570.1 (Kunming isolate), HM581936.1 (Nanjing isolate), JF730744.1 (Korea isolate), HM180089 (Taiwan isolate), HQ406984.1 (US isolate), KC494503.1 (New Zealand isolate), KM379142 .1 (Turkey isolate), KF146703.1 (Venezuela isolate)), under the premise of guaranteeing the amalgamation and versatility of the amplification, by comparative analysis of the highly conserved region of the TSWV N gene, RT-HDA primers were designed for HD- For P1 and HD-P2, after the design is completed, the primers are compared and verified under the Primer-Blast module of the database, and finally the following RT-HDA detection primer sets are selected:
[0043] Upstream primer HD-P1: GGCTTGAATCAGAGGGTGAGA (see SEQ ID NO: 1 in the sequence listing),
[0044] Downstream primer HD-P2: TTGGAGCCACTGACAT...
Embodiment 2
[0053] Embodiment 2 Sensitivity experiment
[0054] (1) Use DEPC water to make 10-fold gradient dilution of TSWV virus RNA template solution downwards, successively 1.56×10 -1 , 1.56×10 -2 , 1.56×10 -3 , 1.56×10 -4 , 1.56×10 -5 , 1.56×10 -6 , 1.56×10 -7 ng / μL, 2 μL each was used as a template for RT-HDA and RT-PCR amplification reactions. Amplification primer sets consist of:
[0055] Upstream primer HD-P1: GGCTTGAATCAGAGGGTGAGA (see SEQ ID NO: 1 in the sequence listing),
[0056] Downstream primer HD-P2: TTGGAGCCACTGACATGACC (see SEQ ID NO: 2 in the sequence listing).
[0057] (2) Extraction of viral RNA
[0058] Take 0.1 g of samples with different dilution concentrations, add liquid nitrogen and grind them into powder, quickly transfer the ground material into a 1.5 mL centrifuge tube, add 1 mL Trizol Reagent, mix by inverting, 2 ° C ~ 8 ° C, 12000 g, centrifuge for 10 min. Take the supernatant, let stand at 15°C-30°C for 5min; add 0.2mL chloroform, shake vigorous...
Embodiment 3
[0068] Embodiment 3: Actual sample detection and comparative experiment
[0069] The disease samples and laboratory samples with typical TSWV symptoms collected from Yunnan, Shandong, Sichuan and other places were detected by RT-HDA and RT-PCR respectively, and the effects of the two methods were compared to further evaluate RT-HDA reliability of the method.
[0070] 1. RT-HDA detection of actual samples
[0071] 1) Extraction of viral RNA
[0072]Take 0.1g sample, grind it into powder with liquid nitrogen, quickly transfer the ground material into a 1.5mL centrifuge tube, add 1mL Trizol Reagent, mix by inversion, 2℃~8℃, 12000g, centrifuge for 10min. Take the supernatant, let stand at 15°C-30°C for 5min; add 0.2mL chloroform, shake vigorously by hand (do not vortex) for about 15s. 15℃~30℃, stand for 2min~3min; 2℃~8℃, 12000g, centrifuge for 15min. Carefully pipette approximately 600 μL of the upper aqueous phase without disturbing the middle and lower phases. Add 500 μL of...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com