A Saccharomyces cerevisiae gene expression system and its construction and application

A Saccharomyces cerevisiae, gene expression technology, applied in the field of genetic engineering, can solve problems such as low protein expression, low plasmid copy number, and inability to meet large-scale production

Active Publication Date: 2018-08-14
JIANGNAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The integration sites of early integrated plasmids are mostly nutritional marker genes, and the copy number in the genome is small, resulting in a small number of integrated plasmid copies, resulting in low protein expression and unable to meet the needs of large-scale production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Saccharomyces cerevisiae gene expression system and its construction and application
  • A Saccharomyces cerevisiae gene expression system and its construction and application
  • A Saccharomyces cerevisiae gene expression system and its construction and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] Example 1: Construction of PR series integrated expression vectors

[0091] 1. Construction of recombinant plasmid pMD-18s rDNA

[0092] (1) According to the whole genome sequence of Spathaspora passalidarum (GenBank accession NZ_AEIK00000000), two primers were designed to intercept the partial sequence of Spathaspora passalidarum 18s rDNA as the homologous recombination site. The primer sequences are as follows: the underlined part of primer P1 is the recognition site of EcoR I, and the underlined part of primer P2 is the recognition site of Bgl II, BamH I and Kpn I respectively from the 5' to 3' ends.

[0093] P1: 5'GCCG GAATTC TGCCAGTAGTCATATGCTTGTCTC3'

[0094] P2: 5'ATATTAGG GGTACC CG GGATCC GA AGATCT GTTGAAGAGCAATAAT3'

[0095] (2) Cultivate Spathaspora passalidarum overnight, collect cells, separate and extract genomic DNA.

[0096] (3) Spathaspora passalidarum genomic DNA was used as a template, and PCR amplification was performed with primers P1 and ...

Embodiment 2

[0131] Example 2: Establishment of PEG / LiAc-mediated Saccharomyces cerevisiae transformation method.

[0132] According to: Guo Zhongpeng. Metabolic Engineering Improves the Fermentation Performance of Industrial Alcoholic Yeast [D]: [Ph.D. Dissertation]. Wuxi: The method provided by Jiangnan University School of Bioengineering, 2011 prepared Saccharomyces cerevisiae ANGA1 as the host bacteria, using PEG / LiAc-mediated transformation of yeast The method is implemented as follows:

[0133] 1. Preparation of Competent State of Saccharomyces cerevisiae ANGA1

[0134] (1) Inoculate the Saccharomyces cerevisiae ANGA1 stored in the cryopreservation tube in the YPD medium, and activate the shake flask for 48 hours.

[0135] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C.

[0136] (3) Pick a single colony of Saccharomyces cerevisiae from a YPD plate, inoculate it in 20ml of YPD medium, and culture it overnight at 30°C in a 100ml shake flask.

[0137...

Embodiment 3

[0153] Example 3: Establishment of electroporation-mediated transformation of yeast Saccharomyces cerevisiae

[0154] According to: Guo Zhongpeng. Metabolic engineering to improve the fermentation performance of industrial alcohol yeast [D]: [Ph. The implementation is as follows:

[0155] 1. Preparation of Saccharomyces cerevisiae ANGA1 electroporation competent cells

[0156] (1) Inoculate the Saccharomyces cerevisiae ANGA1 stored in the cryopreservation tube into YPD medium, and activate the shake flask for 48 hours;

[0157] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C;

[0158](3) Pick a single colony of Saccharomyces cerevisiae from the YPD plate, inoculate it in 20ml YPD medium, and culture it overnight at 30°C in a 100ml shake flask;

[0159] (4) Inoculate the overnight cultured fresh bacterial solution into 50ml YPD medium, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of the bacterial solution reaches a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an integrated Saccharomyces cerevisiae gene expression system which comprises an expression vector, wherein the expression vector sequentially comprises the following operable elements from 5'-3': a pMD19-Tsimple plasmid framework, an rDNA homologous recombinant sequence, an exogenous gene expression cassette and a selective marker gene expression cassette; the exogenous gene expression cassette sequentially comprises a promoter, an exogenous gene insertion enzyme digestion site and a transcription terminator from upstream to downstream; and the selective marker gene expression cassette comprises a promoter, an antibiotic resistance gene and a transcription terminator. The yeast is Saccharomyces cerevisiae. The expression vector can implement integrated stable expression in the Saccharomyces cerevisiae, and has important meanings for fundamental research and product development of the Saccharomyces cerevisiae.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an integrated Saccharomyces cerevisiae gene expression system and its construction method and application. Background technique [0002] With the rapid development of genomics, people are urgently seeking suitable expression systems for the mining of new genes and the construction of new engineered cells. For this reason, various expression systems have emerged, such as bacteria, insect cells, yeast, and mammalian cells. Animal cell expression system, etc. In recent years, the yeast expression system represented by Saccharomyces cerevisiae has become an important tool for metabolic engineering to produce bio-based products, effectively express new foreign genes, and serve basic research, industrial and medical applications due to its unique biological characteristics. Saccharomyces cerevisiae is the yeast that has been produced, lived the longest, and is most closely...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/81C12R1/865
Inventor张梁范贺超高芝李由然石贵阳顾正华李赢丁重阳何冬旭
OwnerJIANGNAN UNIV