A Saccharomyces cerevisiae gene expression system and its construction and application
A Saccharomyces cerevisiae, gene expression technology, applied in the field of genetic engineering, can solve problems such as low protein expression, low plasmid copy number, and inability to meet large-scale production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0090] Example 1: Construction of PR series integrated expression vectors
[0091] 1. Construction of recombinant plasmid pMD-18s rDNA
[0092] (1) According to the whole genome sequence of Spathaspora passalidarum (GenBank accession NZ_AEIK00000000), two primers were designed to intercept the partial sequence of Spathaspora passalidarum 18s rDNA as the homologous recombination site. The primer sequences are as follows: the underlined part of primer P1 is the recognition site of EcoR I, and the underlined part of primer P2 is the recognition site of Bgl II, BamH I and Kpn I respectively from the 5' to 3' ends.
[0093] P1: 5'GCCG GAATTC TGCCAGTAGTCATATGCTTGTCTC3'
[0094] P2: 5'ATATTAGG GGTACC CG GGATCC GA AGATCT GTTGAAGAGCAATAAT3'
[0095] (2) Cultivate Spathaspora passalidarum overnight, collect cells, separate and extract genomic DNA.
[0096] (3) Spathaspora passalidarum genomic DNA was used as a template, and PCR amplification was performed with primers P1 and ...
Embodiment 2
[0131] Example 2: Establishment of PEG / LiAc-mediated Saccharomyces cerevisiae transformation method.
[0132] According to: Guo Zhongpeng. Metabolic Engineering Improves the Fermentation Performance of Industrial Alcoholic Yeast [D]: [Ph.D. Dissertation]. Wuxi: The method provided by Jiangnan University School of Bioengineering, 2011 prepared Saccharomyces cerevisiae ANGA1 as the host bacteria, using PEG / LiAc-mediated transformation of yeast The method is implemented as follows:
[0133] 1. Preparation of Competent State of Saccharomyces cerevisiae ANGA1
[0134] (1) Inoculate the Saccharomyces cerevisiae ANGA1 stored in the cryopreservation tube in the YPD medium, and activate the shake flask for 48 hours.
[0135] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C.
[0136] (3) Pick a single colony of Saccharomyces cerevisiae from a YPD plate, inoculate it in 20ml of YPD medium, and culture it overnight at 30°C in a 100ml shake flask.
[0137...
Embodiment 3
[0153] Example 3: Establishment of electroporation-mediated transformation of yeast Saccharomyces cerevisiae
[0154] According to: Guo Zhongpeng. Metabolic engineering to improve the fermentation performance of industrial alcohol yeast [D]: [Ph. The implementation is as follows:
[0155] 1. Preparation of Saccharomyces cerevisiae ANGA1 electroporation competent cells
[0156] (1) Inoculate the Saccharomyces cerevisiae ANGA1 stored in the cryopreservation tube into YPD medium, and activate the shake flask for 48 hours;
[0157] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C;
[0158](3) Pick a single colony of Saccharomyces cerevisiae from the YPD plate, inoculate it in 20ml YPD medium, and culture it overnight at 30°C in a 100ml shake flask;
[0159] (4) Inoculate the overnight cultured fresh bacterial solution into 50ml YPD medium, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of the bacterial solution reaches a...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap