Chinese Simmental cattle FGF-1 gene as genetic markers of carcass meat quality
A technology of FGF-1 and Simmental cattle, applied in the field of cattle breeding for both meat and milk, achieving high accuracy, reliable molecular markers, and low cost effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Obtaining bovine FGF-1 gene fragments and establishing a method for detecting polymorphisms in functional regions.
[0033] 1.1 Test material:
[0034] 449 28-month-old Chinese Simmental bulls came from Baolongshan beef cattle fattening farm in Tongliao City, Inner Mongolia. Jugular vein blood collection, all blood samples were 10 mL / head, anticoagulated with ACD anticoagulant, and frozen at -20°C. Genomic DNA was extracted from blood samples using a genomic DNA extraction kit.
[0035] 1.2 Primer design and PCR amplification:
[0036] The Chinese Simmental cattle were selected as the test material, and the following 3 pairs of primers were designed according to the bovine FGF-1 gene sequence:
[0037] P1 forward primer F: 5' TCCCTGGTTCAGAGTTCAAG 3',
[0038] P1 reverse primer R: 5' GGGTGTGGGTGCTGTTATC 3';
[0039] P2 forward primer F: 5'GTTCGTAGAGAGCCACAGATG3',
[0040] P2 reverse primer R: 5'ATCACTGTGCCAAAGGAAAT 3';
[0041] P3 forward primer F: 5' GTAGACGGCACACA...
Embodiment 2
[0051] Polymorphism distribution detection of genetic markers obtained from screening in Chinese Simmental cattle population.
[0052] Detection of PCR-Xsp-Ⅰ-RFLP, PCR-Hae-III-RFLP and PCR-Rsa- -RFLP polymorphism distribution frequency. The test results showed that among the three genotypes of SNP1 (I2-8528 A>T), the proportion of wild-type AA individuals was relatively high, and the proportion of mutant TT individuals was very low. The frequency distributions of are significantly different, and the frequency of allele A is 0.77, which is the dominant gene. Among the three genotypes of SNP2 (I2-72251 A>C), the proportion of wild-type AA individuals was relatively high, and the proportion of mutant CC individuals was rarely 0.045; the frequency of allele A was 0.75, which was the dominant gene. Among the three genes of SNP3 (I2-13970 A>T), the mutant individuals were more dominant, the ratio of the wild type was only 0.13, and the allele T had a significant advantage, the ra...
Embodiment 3
[0056] Association analysis and application of FGF-1 gene functional region genetic markers obtained from screening with carcass and meat quality traits of Chinese Simmental cattle.
[0057] Determination of traits: The carcass traits and meat quality traits studied include carcass weight, net meat percentage, hind leg circumference, hind leg width, hind leg length, thigh meat thickness, loin meat thickness, carcass length, carcass depth, carcass chest depth, backfat and carcass fat coverage, live eye muscle area and 14 kinds of unsaturated fatty acid content in the longissimus dorsi and lumbar muscles. The determination of all characters is carried out according to the national standard GB / T1723821998.
[0058] In order to determine the correlation between the A 8528 T, A 72251 C, and A 13970 T mutation sites in the intron region of the FGF-1 gene and the carcass and meat quality traits of Chinese Simmental cattle, the PCR - Xsp - established in Example 1 was used Ⅰ-RFLP, PC...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap