Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chinese Simmental cattle FGF-1 gene as genetic markers of carcass meat quality

A technology of FGF-1 and Simmental cattle, applied in the field of cattle breeding for both meat and milk, achieving high accuracy, reliable molecular markers, and low cost effects

Active Publication Date: 2015-05-20
JILIN UNIV
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the detection of genetic polymorphisms of FGF-1 gene and its correlation with growth and development, carcass composition and meat quality traits of Chinese Simmental cattle.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chinese Simmental cattle FGF-1 gene as genetic markers of carcass meat quality
  • Chinese Simmental cattle FGF-1 gene as genetic markers of carcass meat quality
  • Chinese Simmental cattle FGF-1 gene as genetic markers of carcass meat quality

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Obtaining bovine FGF-1 gene fragments and establishing a method for detecting polymorphisms in functional regions.

[0033] 1.1 Test material:

[0034] 449 28-month-old Chinese Simmental bulls came from Baolongshan beef cattle fattening farm in Tongliao City, Inner Mongolia. Jugular vein blood collection, all blood samples were 10 mL / head, anticoagulated with ACD anticoagulant, and frozen at -20°C. Genomic DNA was extracted from blood samples using a genomic DNA extraction kit.

[0035] 1.2 Primer design and PCR amplification:

[0036] The Chinese Simmental cattle were selected as the test material, and the following 3 pairs of primers were designed according to the bovine FGF-1 gene sequence:

[0037] P1 forward primer F: 5' TCCCTGGTTCAGAGTTCAAG 3',

[0038] P1 reverse primer R: 5' GGGTGTGGGTGCTGTTATC 3';

[0039] P2 forward primer F: 5'GTTCGTAGAGAGCCACAGATG3',

[0040] P2 reverse primer R: 5'ATCACTGTGCCAAAGGAAAT 3';

[0041] P3 forward primer F: 5' GTAGACGGCACACA...

Embodiment 2

[0051] Polymorphism distribution detection of genetic markers obtained from screening in Chinese Simmental cattle population.

[0052] Detection of PCR-Xsp-Ⅰ-RFLP, PCR-Hae-III-RFLP and PCR-Rsa- -RFLP polymorphism distribution frequency. The test results showed that among the three genotypes of SNP1 (I2-8528 A>T), the proportion of wild-type AA individuals was relatively high, and the proportion of mutant TT individuals was very low. The frequency distributions of are significantly different, and the frequency of allele A is 0.77, which is the dominant gene. Among the three genotypes of SNP2 (I2-72251 A>C), the proportion of wild-type AA individuals was relatively high, and the proportion of mutant CC individuals was rarely 0.045; the frequency of allele A was 0.75, which was the dominant gene. Among the three genes of SNP3 (I2-13970 A>T), the mutant individuals were more dominant, the ratio of the wild type was only 0.13, and the allele T had a significant advantage, the ra...

Embodiment 3

[0056] Association analysis and application of FGF-1 gene functional region genetic markers obtained from screening with carcass and meat quality traits of Chinese Simmental cattle.

[0057] Determination of traits: The carcass traits and meat quality traits studied include carcass weight, net meat percentage, hind leg circumference, hind leg width, hind leg length, thigh meat thickness, loin meat thickness, carcass length, carcass depth, carcass chest depth, backfat and carcass fat coverage, live eye muscle area and 14 kinds of unsaturated fatty acid content in the longissimus dorsi and lumbar muscles. The determination of all characters is carried out according to the national standard GB / T1723821998.

[0058] In order to determine the correlation between the A 8528 T, A 72251 C, and A 13970 T mutation sites in the intron region of the FGF-1 gene and the carcass and meat quality traits of Chinese Simmental cattle, the PCR - Xsp - established in Example 1 was used Ⅰ-RFLP, PC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Chinese Simmental cattle FGF-1 gene as genetic markers of carcass meat quality. According to the method, the Chinese Simmental cattle genome DNA or a DNA sequence comprising the Chinese Simmental cattle FGF-1 gene is taken as a template, the functional region segment of the Chinese Simmental cattle FGF-1 gene is amplified by use of PCR primer pairs P1, P2 and P3, enzyme digestion and electrophoretic analysis are performed on restriction enzymes Xsp-I, Hae-III and Rsa-I by virtue of sequencing screening, and then the SNPs at the 8528th site, the 13970th site and the 72251th site of the second introns of the Chinese Simmental cattle FGF-1 gene can be determined (A is greater than T, A is greater than T and A is greater than C). The T allel gene and the TT genotype of the SNP1 site, the C allel gene and the CC genotype of the SNP2 site and the T allel gene and the TT genotype of the SNP3 site in the SNPs obtained by screening can be taken as effective molecular genetic markers for remarkably improving the carcass composition and meat quality traits of the Chinese Simmental cattle, and then can be used for selective molecular breeding under the assistance of early marking of the carcass composition and meat quality traits of the beef cattle.

Description

technical field [0001] The invention discloses a Chinese Simmental cattle FGF-1 gene as a genetic marker for carcass meat quality, and relates to the detection of Chinese Simmental cattle carcass composition and the detection of molecular genetic markers for meat quality traits and its use as an auxiliary selection marker in the breeding of meat and milk dual-purpose cattle The application in the invention belongs to the technical field of meat and milk dual-purpose cattle breeding. Background technique [0002] Chinese Simmental is the leading breed in the industrialized production of beef cattle in my country. With the changes in domestic and foreign markets and the increase in consumer demand for beef, further breeding and improvement of the performance of Chinese Simmental beef has become the main goal of this breed. In order to improve meat performance, conventional breeding techniques and molecular breeding methods must be used to select for growth and development tra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/683C12Q1/6869C12Q1/6888C12Q2600/124C12Q2600/156C12Q2531/113C12Q2521/301
Inventor 杨润军赵志辉许黄涛谭宇鹏房希碧芦春艳
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com