Application of miR-425 in tumor diagnosis, treatment and prognosis
A mir-425, 1.mir-425 technology, applied in the application field of miR-425 in the diagnosis, treatment and prognosis of tumors, can solve the problem of poor curative effect and insignificant survival rate of patients with middle-advanced and metastatic recurrence Improve other problems, achieve the effect of inhibiting proliferation and metastasis, enhancing sensitivity, and reducing cell proliferation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1: miR-425 is upregulated in tumor samples
[0047] 1. TCGA database analysis
[0048] Methods: All statistical analyzes were processed with SPSS17.0 statistical software. The independent t-test (constant variable) was used for comparison between different groups, the t-test was used for the comparison of means between two groups, and the χ test was used for the comparison of categorical variables 2 One-way analysis of variance was used for comparison among multiple groups. Values are expressed as mean ± SD. test coefficient P < 0.05 was considered a statistically significant difference. Lung cancer, liver cancer, bladder cancer, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, head and neck squamous cell carcinoma, kidney cancer, prostate cancer and ovarian cancer were analyzed by SPSS statistical analysis method in TCGA (The Cancer Genome Altas Project) database. The expression of miR-425 in cancer microRNA expression profiling...
Embodiment 2
[0059] Example 2: Construction of cell lines stably and highly expressing miR-425 and cell lines transfected with antimiR-425.
[0060] 1. Construction of a stable cell line with high expression of miR-425
[0061] (1) Construct the expression plasmid of miR-425
[0062] The full-length cDNA sequence of the miR-425 precursor was amplified by PCR, and the primer sequences were as follows:
[0063] FP: GCCAGATCTGCAACGGAATCCCAAAA (SEQ ID NO: 6)
[0064] RP: GCCGAATTCCAAATAATGCGACCATAATAGAA (SEQ ID NO: 7)
[0065] The purified full-length sequence of miR-425 was constructed into the pMSCV-retro-puro expression vector (purchased from Clontech Company) to obtain the miR-425 overexpression plasmid pMSCV-retro-puro-miR-425.
[0066] (2) Transfect human lung cancer cell A549 and liver cancer cell HepG2
[0067]The obtained pMSCV-retro-puro-miR-425 and the control pMSCV-retro-puro empty vector were transformed into 293FT cells by using Lipofectamine2000 (Invitrogen, #11668) and ...
Embodiment 3
[0074] Example 3: Functional research of miR-425 in lung cancer cells and liver cancer cells
[0075] 1. Detection of Tumor Cell Proliferation
[0076] (1) In vitro experiment: cell growth experiment
[0077] MTT [3-4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide assay was used to detect the changes in the growth rate of cells with high miR-425 expression and miR-425 silence. The experimental operation was carried out according to the instructions of the cell proliferation MTT kit (Roche, Mannheim). The brief description is as follows: the experimental group cells (HepG2-miR-425 and HepG2-antimiR-425) or the control group cells (HepG2-VectorA and HepG2-Control) were divided into 1×10 4 Cells / well were inoculated in 24-well culture plates, and 100 μL of MTT labeling mixture with a concentration of 10.3 mg / mL was added to a group of cells every 24 hours, and the absorbance was measured with a microplate reader (Tecan) after 4 hours of incubation ( OD value...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com