Method for knocking out HPV (human papilloma virus) E6E7 oncogene by use of TALEN (transcription activator-like effector nuclease)

A human papillomavirus, E6E7 technology, applied in the field of knocking out high-risk human papillomavirus E6E7 oncogene, can solve the problems of frame shift mutation, gene insertion or deletion, etc.

Active Publication Date: 2015-07-01
武汉雅马生物工程有限公司
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Homologous recombination can be repaired with another sister chromatid or other DNA templates, which is a high-fidelity repair method; non-homologous end joining is the condition of eukaryotic cells without relying on DNA homologous sequences. Directly link two DNA breaks together. Although this repair method can avoid the impact of DNA degradation caused by DNA breaks on cell survival, it is very easy to introduce small fragments of gene insertion or deletion at the break point, resulting in frame shift. Mutations that ultimately downregulate the function of the gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out HPV (human papilloma virus) E6E7 oncogene by use of TALEN (transcription activator-like effector nuclease)
  • Method for knocking out HPV (human papilloma virus) E6E7 oncogene by use of TALEN (transcription activator-like effector nuclease)
  • Method for knocking out HPV (human papilloma virus) E6E7 oncogene by use of TALEN (transcription activator-like effector nuclease)

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0036] Example 1. Construction of TALEN-512 expression vector

[0037] The full-length sequence information of the E6E7 oncogene of HPV16 was obtained from the NCBI website, and the sequence was copied to the TALEN RVD sequence online design tool (https: / / tale-nt.cac.cornell.edu / node / add / talen / ) to complete the design. The TALENs pair targeting the 512th base of the HPV16E7 gene (counting from the first base of the E6E7 gene) was selected and named TALEN-512. The targeted DNA sequence is:

[0038] TALEN-512: ATGTTAGATTTGCAACCAGAGACAACTgatctctactgttatgagcAATTAAATGACAGCTCAGAGGAGG

[0039] Among them, the capital letter is the recognition and binding region of TALE, and the lowercase letter part is the Spacer region, that is, the FokI enzyme cleavage region in TALEN. specifically,

[0040] TALEN-512L: ATGTTAGATTTGCAACCAGAGACAACT

[0041] TALEN-512R: CCTCCTCTGAGCTGTCATTTTAATT

[0042] The preferred RVD sequence corresponding to the recognition module TALEN-512L:

[0043] N...

example 2

[0048] Example 2. TALEN-512 induces apoptosis

[0049] The TALENs expressed after transfection of TALEN-512 targeting HPV16E6E7 into cells can quickly recognize and bind to the target sequence, and the FokI endonucleases expressed on the two monomers are spatially close and dimerize cleavage of the target sequence, forming a double-strand DNA break (DSB), which initiates the cell's self-repair. Because cells preferentially use the error-prone NHEJ method for repair, it is easy to cause base insertion or deletion during repair, resulting in frame-shift mutation of codons, which eventually inhibits the expression of HPV16E6E7 protein. The expression of E6E7 protein is the prerequisite for the immortalization of HPV-infected cells. Therefore, after the expression of E6E7 protein is inhibited, the proliferation ability of HPV-infected cells decreases and the apoptosis ability increases.

[0050] The specific operation method is:

[0051] (1) Cell culture

[0052] Cervical cance...

example 3

[0058] Example 3. Verification of cutting efficiency of TALEN-512

[0059] The DSBs formed by cutting TALEN after functioning in cells can rapidly induce cells to repair themselves. In eukaryotic cells, in order to avoid the impact of DNA degradation caused by DNA breaks on cell survival, most cells use NHEJ to directly connect the two ends, but this error-prone repair method is very easy to introduce small DNA fragments at the break point. The gene insertion or deletion of the fragment causes the frame shift mutation of the codon, which finally hinders the expression of the target gene. At this time, if the nucleotide sequence that has been cleaved by TALEN and repaired by the cell is mixed with the untreated normal (wild-type) nucleotide sequence and then annealed and extended, a cleavage site can be formed. A specific hybrid duplex where there is a mismatch (corresponding to a repaired base insertion or deletion). This hybrid duplex can be recognized by T7 Endonuclease I ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene therapy and discloses a fixed-point knockout system for high-risk HPV (human papilloma virus) E6E7 gene, namely targeted cutting of TALENs (transcription activator-like effector nucleases) of HPV E6E7 gene, wherein a TALENs expression vector of the target specific site is designed according to the high-risk HPV E6E7 gene sequence, and the HPV E6E7 gene sequence in the cells are cut in a targeted manner so as to knock out the target gene and induce the apoptosis increase and proliferation inhibition of corresponding subtype cells while the TALENs do not act on the HPV positive or HPV negative cells of other subtypes. By transfecting the TALEN expression vector in a subcutaneous tumor model of HPV positive cervical cancer cells, the growth of subcutaneous tumor can be obviously inhibited, and the tumor weight is reduced. According to the method for targeted knockout of high-risk HPV E6E7 gene using TALEN provided by the invention, the virus oncogene can be efficiently broken on the DNA level so as to cause apoptosis and proliferation inhibition of the HPV infected cells, and the method is of tremendous therapeutic value on HPV infection related diseases and particularly precancerous lesions such as cervical intraepithelial neoplasias.

Description

technical field [0001] The invention relates to the field of gene therapy, and the invention discloses a method for constructing a targeted TALEN plasmid for the high-risk human papillomavirus E6E7 oncogene sequence, and a method for knocking out the high-risk human papillomavirus E6E7 oncogene by using the TALEN . Background technique [0002] Cervical cancer is the third most common malignancy and the fourth most deadly malignancy in women worldwide. According to statistics, in 2008, there were 529,800 new cases worldwide, accounting for 9% of the total number of all tumors, of which 275,100 were deaths, accounting for 8% of the total deaths of female tumor patients; these new cases and deaths accounted for 8% in developing countries More than 85% (Crosbie EJ et al., The Lancet Magazine, 2013, 382: 889-899; Jemal A et al., CA: a cancer journal for clinicians, 2011, 61: 69-90). [0003] High-risk human papillomavirus (Human Papillomavirus, HPV), especially the two high-ri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/22C12N15/55
Inventor马丁汪辉胡争丁文成于兰
Owner武汉雅马生物工程有限公司