Method for detecting pseudomonas syringaepv altinidia through recombinase-mediated isothermal amplification technology

An isothermal amplification, canker bacteria technology, applied in recombinant DNA technology, microorganism-based methods, biochemical equipment and methods, etc., can solve problems such as no application, and achieve high specificity and stability, and the effect of simple and fast reaction

Inactive Publication Date: 2015-07-08
SICHUAN AGRI UNIV
View PDF1 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, this technology has been applied to the detection of coronavirus, HIV virus, cancer, etc., but ther...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting pseudomonas syringaepv altinidia through recombinase-mediated isothermal amplification technology
  • Method for detecting pseudomonas syringaepv altinidia through recombinase-mediated isothermal amplification technology
  • Method for detecting pseudomonas syringaepv altinidia through recombinase-mediated isothermal amplification technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] 1. Primer design:

[0041] In this experiment, multiple sets of RPA primers were designed according to the 16S-23S rDNA sequence of P. kiwifruit canker sores, and then two sets of primers were selected for RPA amplification reaction. The sequences of these two sets of primers are:

[0042] Primer name

Sequence 5'-3'

RPA Psa1-F

CCTGATAAGGGTGAGGTCGGCAGTTCGAATC

RPA Psa1-R

TCACGCACCCTTCAATCAGGATGGAATGCTC

RPA PSA2-F

AGAAGCAGCTTTTGCTTTGCACACCCGATTTT

RPA PSA2-R

AATCAACATTCACGCACCCTTCAATCAGGATG

[0043] 2. The cultivation of kiwifruit canker bacteria:

[0044] The kiwifruit canker bacteria were put into the liquid LB medium and cultured at 22°C for 12 hours.

[0045] 3. Total DNA extraction of canker bacteria:

[0046] Take 1ml of the above-mentioned cultured bacteria solution, centrifuge to collect ulcer bacteria, extract DNA according to the instructions of the bacterial DNA extraction kit, measure the concentr...

Embodiment 2

[0051] Example 2: Rapid Analysis of RPA

[0052] According to the primers identified in Example 1 above, several reaction time gradients were designed, namely 5min, 10min, 20min, 30min, 40min, 60min, 120min, and the influence of RPA reaction time on detection was analyzed. It was found that the target bands could not be detected after 5 minutes and 10 minutes of reaction, and the target fragments could be detected after 20 minutes, but the amplified fragments did not increase with the prolongation of the reaction time, indicating that RPA has high enzymatic activity and can be detected in a relatively short time. The DNA fragments were amplified within a certain time, and the experiment determined that the optimal reaction time of the RPA reaction was 20 min. Experimental results such as figure 2 shown.

Embodiment 3

[0053] Embodiment 3: Sensitivity analysis of PCR and RPA detection

[0054] The total DNA of P. kiwifruit canker was diluted to 50ng / μL, and then diluted according to 50 times, 100 times, 200 times, 300 times and 600 times for PCR and RPA detection. The primers used for PCR detection refer to Rees-George (Rees-George, J., Vanneste, J.L., Cornish, D.A., Pushparajah, I.P.S., Yu, J., Templeton, M.D., and Everett, K.R. 2010. Detection of Pseudomonas syringae pv.actinidiae using polymerase chai n reaction (PCR) primers based on the 16S-23S rDNA intertranscribed spacer region and compari son with PCR primers based on other gene regions.Plant Pathol.59:453-464) published primers, wherein the upstream primer 5'-TTTTGCTTTGCACACCCGATTTT-3'; the downstream primer is 5'-CACGCACCCTTCAATCAGGATG-3'. The experimental results show that both PCR and RPA can see the target fragment when the concentration of 50ng / μL DNA is diluted to 600 times, which proves that RPA and PCR have high detection s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for detecting pseudomonas syringaepv altinidia through the recombinase-mediated isothermal amplification technology and belongs to the technical field of phytobacteriology diagbosis. The method mainly includes the steps that general DNA of the pseudomonas syringaepv altinidia is extracted, an RPA reaction and 2.5% agarose gel electrophoresis detection are performed, and fast detection of the pseudomonas syringaepv altinidia is performed in the aspect of the molecular level. The method has the advantages of being fast, sensitive, convenient to use and specific. Compared with a conventional PCR method, primers obtained through the method in a screened mode have high specificity and stability on amplification of target fragments, amplification time is short, annealing is not needed during the reaction, the high activity of the RPA reaction can be kept when required temperature can be maintained under any condition of a constant-temperature incubator, a water bath kettle and human body temperature, and no expensive instruments are needed. Due to the method, a detection system of the pseudomonas syringaepv altinidia is successively established, the practicability of the system is verified through sample detection, and the method for detecting the pseudomonas syringaepv altinidia is fast and effective.

Description

technical field [0001] The invention belongs to the technical field of plant bacteriological diagnosis, and in particular relates to the detection of plant pathogens by using an isothermal amplification technology, in particular to a method for detecting kiwifruit canker pathogen by using a recombinase-mediated isothermal amplification technology. Background technique [0002] my country is the main producing area of ​​kiwifruit, and its planting area and output both rank first in the world. Kiwifruit canker is a devastating disease, which has different degrees of harm to all major kiwifruit producing areas in my country, and seriously threatens the sustainable development of my country's kiwifruit industry. It is listed as the national forest plant quarantine control object. The disease is ferocious, and it will directly affect the yield and fruit quality of kiwifruit, and cause serious economic losses to the kiwifruit industry in my country. [0003] Kiwifruit canker is a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/38
CPCC12Q1/689C12Q1/6844C12Q2521/507C12Q2521/101C12Q2522/101
Inventor 杨辉陈航龚国淑刘童李庆张敏
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap