Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cephalosporin G producing recombinant strain, construction method and applications thereof

The technology of a cephalosporin and a construction method is applied to the recombinant bacteria producing cephalosporin G and the fields of its construction and application, and can solve the problems of high cost and low transformation efficiency of cephalosporins.

Active Publication Date: 2015-07-29
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Mainly because DAOCS is unstable in vitro, the conversion efficiency is low, and the reaction requires α-ketoglutarate as a cofactor, resulting in high cost of enzymatic preparation of cephalosporins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cephalosporin G producing recombinant strain, construction method and applications thereof
  • Cephalosporin G producing recombinant strain, construction method and applications thereof
  • Cephalosporin G producing recombinant strain, construction method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0103] Example 1. Construction of recombinant plasmid pDB1S-H7 expressing deacetoxycephalosporin C synthetase (expandase)

[0104] Design a pair of primers (scDAOCS-F: AACATG CCATGG ACACGACGGTGCCCCACCTTCA and scDAOCS-R: CCG GAATTCTTACTATGCCTTGGATGTGCGGCGCA), using pET30a-H7 as a template (Ji J, Fan K, Tian X, Zhang X, Zhang Y, Yang K. Iterative Combinatorial Mutagenesis as an Effective Strategy for Generation of Deacetoxycephalosporin C Synthase with Improved Activity toward Penicillin G. Applied and environmental microbiology2012,78:7809-7812.), the coding gene (H7) of deacetoxycephalosporin C synthetase (scDAOCS) was amplified by PCR. The PCR conditions are as follows: 95°C, 2min; 95°C, 20sec; 55°C, 20sec (30 cycles); 72°C, 15sec; 72°C, 5min. Detected by 1% agarose gel electrophoresis, the fragment size is about 1000bp, consistent with the target fragment. After the H7 gene was digested with NcoI and EcoRI, the H7 gene fragment was recovered.

[0105] pDB1S ( Figure ...

Embodiment 2

[0107] Embodiment 2, the construction of Escherichia coli mutant PG01, PG02, PG04, PG06, PG08, PG10 and PG12

[0108] In this example, Escherichia coli K12 was subjected to different single gene knockouts to construct PG01, PG02, PG04, PG06, PG08, PG10, PG12 and other single gene knockout strains. The whole genome sequence of Escherichia coli K12 is GenBank Accession: U00096.3 (GI: 545778205, update date is Nov15, 201301:09PM, version is 3).

[0109] 1. Escherichia coli mutant PG01 (purchased from the National Institute of Genetics (NIG, Japan), NIG number JW0715) (Baba et al., 2006) is the α-ketoglutarate dehydrogenase gene of Escherichia coli K12 (sucA) is replaced by the kanamycin resistance gene (about 1300bp) with FRT sites at both ends to knock out (delete) the sucA of E. coli K12 E. coli K12 mutant. It is referred to as PG01 in this application. sucA encodes the protein shown in SEQ ID No.5, and the coding sequence of sucA is shown in SEQ ID No.6. The genotype of PG0...

Embodiment 3

[0167] Embodiment 3, pDB1S-H7 transforms Escherichia coli and its mutants to construct engineering strains

[0168] The pDB1S-H7 in Example 1 was transformed into E. coli K12 and E. coli mutants PG01, PG02, PG04, PG06, PG08, PG10, PG12, PG03, PG14, PG16, PG17, PG18, PG19, PG05, PG15, PG20, PG21 and PG22, on the LB plate containing streptomycin (the concentration of streptomycin is 50 μg / ml), screen positive clones (clones that can grow on the plate containing streptomycin), positive clones Use the primers in Example 1 to carry out PCR verification on scDAOCS-F and scDAOCS-R, which can amplify the deacetoxycephalosporin C synthetase (expandase) gene containing the coding sequence of SEQ ID No.2 The DNA fragments are positive clones. SDS-PAGE electrophoresis after positive clones were induced figure 2 As shown, the desacetoxycephalosporin C synthetase of 34.7 kDa was expressed in each positive clone strain. Among them, the positive clone strain obtained by transforming pDB1S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The present invention discloses a cephalosporin G producing recombinant strain, a construction method and applications thereof. The construction method comprises: transforming an expandase gene into recipient bacteria to obtain the cephalosporin G producing recombinant strain, wherein the recipient bacteria are mutation type escherichia coli or wild-type escherichia coli. Experiment results show that the yield of the cephalosporin G producing recombinant strain is 2.67-29.01 mM (0.89-9.64 g / L).

Description

technical field [0001] The invention relates to a recombinant bacterium producing cephalosporin G and its construction method and application. Background technique [0002] 7-Amino-desacetoxy cephalosporanic acid (7-Amino-3-Desacetoxy Cephalosporanic Acid, 7-ADCA) is the mother nucleus of cephalosporins, and is an important intermediate for the preparation of cephalosporin antibiotics such as cephalexin, cephradine and cefadroxil. one of the bodies. The industrial synthesis method of 7-ADCA mainly includes two steps: (1) chemical ring expansion of penicillin G to generate 7-phenylacetylaminodesacetoxycephalosporanic acid, also known as phenylacetyl-7-ADCA or cephalosporin G (phenylacetyl -7-ADCA, G-7-ADCA, DAOG); (2) G-7-ADCA is catalyzed by penicillin G acylase to remove the side chain to obtain 7-ADCA. The step of removing the side chain has been fully studied, and the ring expansion reaction has become an important research direction in the synthesis process. The ring ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12P35/00C12P35/02C12R1/19
Inventor 林白雪赵健杨克迁陶勇
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com