Primers, kit and pcr method for detecting jak2 gene v617f polymorphism
A V617F, locus polymorphism technology, applied in the field of molecular biology gene detection, can solve the problems of inability to detect large-scale clinical specimens at the same time, complicated interpretation of kit results, and low clinical popularity, so as to avoid locus mismatch. , the detection speed is fast, the effect of good sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0118] Example 1: Preparation of wild type and mutant positive plasmids for JAK2 gene V617F polymorphic site
[0119] JAK is a non-receptor tyrosine protein kinase, among which JAK2 mutation is closely related to myeloproliferative diseases. JAK2 gene V617F mutation can lead to abnormal activation of JAK-STAT signaling pathway, resulting in abnormal proliferation of bone marrow cells. In the 2008 World Health Organization (WHO) classification system, JAK2 mutation has become the main diagnostic index of chronic myeloproliferative disease (MPD).
[0120] First, we called out the gene sequence before and after the V617F polymorphic site of the JAK2 gene from the gene bank, and marked the polymorphic site with a double underline, at the appropriate position upstream and downstream of the V617F polymorphic site of the JAK2 gene ( Marked in bold and underlined), design a pair of cloning primers, the amplified fragment is 228bp, including the mutation site, the gene sequence is show...
Embodiment 2
[0137] Example 2: Design and specificity screening of allele-specific primers (ASP)
[0138] For JAK2-V617F, design wild-type and a series of mutant-specific primers as follows:
[0139] JAK2-V617F-WT-R: ttacttactctcgtctccacacac (SEQ No. 8)
[0140] JAK2-V617F-mut-R: tttacttactctcgtctccacacaa (SEQ No. 9)
[0141] JAK2-V617F-mut-R1: tacttactctcgtctccacacaa (SEQ No. 10)
[0142] JAK2-V617F-mut-R2: acttactctcgtctccacacaa (SEQ No. 11)
[0143] JAK2-V617F-mut-R3: ctttacttactctcgtctccacagga (SEQ No. 12)
[0144] JAK2-V617F-mut-R4:cttacttactctcgtctccacagga (SEQ No. 13)
[0145] JAK2-V617F-mut-R5: ctacttactctcgtctccacagga (SEQ No. 14)
[0146] Simultaneously design and synthesize Taqman-specific probes:
[0147] SEQ No. 15: FAM-tgaagcagcaagtatgatgagcaagc-BHQ1.
[0148] Relevant primers and probes were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.
[0149] Then use the above 7 primers to pair with the common downstream primer JAK2-V617F-F: 5'-ggacaacagtcaaacaacaattc-3...
Embodiment 3
[0151] Embodiment 3: ASP sensitivity screening
[0152] Then use No. 7 mutant primers to pair with the common downstream primer SEQ No.16 of the JAK2 gene, and use mutant recombinant plasmids according to 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 0 for serial dilution, plus Taqman-specific probes, sensitivity verification was performed on a fluorescent quantitative PCR instrument. The No. 7 mutation-specific primer can detect 100 copies of the mutant, so this primer is the best primer for detecting the V617F polymorphism site of the JAK2 gene screened according to our method, as shown in Table 3.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



