Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of LRK2 gene or encoding protein thereof in promotion of rice tillering

A technology that encodes proteins and genes, and is used in applications, genetic engineering, plant genetic improvement, etc.

Active Publication Date: 2015-08-12
ZHEJIANG NORMAL UNIVERSITY
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

According to the analysis of cloned QTL or gene structure, there is no report of leucine-rich repeat receptor-like protein kinase related to production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of LRK2 gene or encoding protein thereof in promotion of rice tillering
  • Application of LRK2 gene or encoding protein thereof in promotion of rice tillering
  • Application of LRK2 gene or encoding protein thereof in promotion of rice tillering

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1 construction vector

[0029] 1. Primers used to construct the vector:

[0030] LRK2-1300-KpnI-F: GTCGGTACCATGCAGCCACCTCATTCTTCATGCAAC;

[0031] LRK2-1300-SalI-R: CAGGTCGACTCAGTCGGAGCCTACACTGTCCAG;

[0032] 2. Recombinant vector

[0033] ① Acquisition of LRK2 gene:

[0034] Extraction of rice total DNA:

[0035] 1) Put fresh rice leaves into a 1.5ml centrifuge tube and add 200μl of lysate.

[0036] 2) Use a grinding rod to grind the leaves into a homogenous slurry as much as possible to facilitate cracking.

[0037] 3) Place the centrifuge tube in a 65°C oven and incubate for 30 minutes, and mix thoroughly every 10 minutes.

[0038] 4) Take the centrifuge tube out of the oven, add 65 μl of 5M KAC solution, mix gently by inverting up and down, and then place it in an ice bath at -20°C for 5 minutes.

[0039] 5) Add 300 μl of chloroform, vigorously shake and mix, and centrifuge at 12000 rpm for 10 min.

[0040] 6) Take about 300μl of the supernatant, a...

Embodiment 2

[0088] Obtaining and identification of embodiment 2 transgenic rice

[0089] 1) Acquisition of transgenic rice

[0090] Rice receptor: Nipponbare.

[0091] Required culture medium (liquid):

[0092] Mature embryo callus induction medium: NB+2mg / L 2,4-D, pH=5.8, plant gel 3g / L;

[0093] Agrobacterium activation medium: YEP, pH=7.0;

[0094] Agrobacterium expansion medium: YEB+200μM AS, pH=7.0;

[0095] Agrobacterium suspension infection liquid: NB+2mg / L 2,4-D+200μM AS, pH=5.4;

[0096] Co-cultivation medium of callus and Agrobacterium: NB+2mg / L 2,4-D+200μM AS, pH=5.4, Phytogel 3g / L;

[0097] Transgenic callus selection medium: NB+2mg / L 2,4-D+500mg / L Cef+150mg / L G418 or 50mg / L Hyg, pH=5.8, Phytogel 3g / L;

[0098] Transgenic callus differentiation medium: MS+0.5mg / L NAA+2mg / L 6-BA+0.5mg / L KT+75mg / L G418 or 25mg / L Hyg+125mg / L Cef, pH=5.8, Phytogel 3g / L;

[0099] Rooting medium for tissue culture regenerated shoots: 1 / 2MS+35mg / L G418 or 15mg / L Hyg+50mg / L Cef, pH=5.8, plant ...

Embodiment 3

[0119] Example 3 LRK2 promoter expression analysis

[0120] Prepare GUS dye solution, the formula is shown in Table 3. Submerge specific transgenic rice tissues (such as leaves, spikelets, stems, stem nodes, roots, and rhizome-combined bases) in GUS staining solution, vacuumize for 30-60min, and overnight at 37°C; remove plant materials with absolute ethanol Background color, photographed and recorded, stored at 4°C.

[0121] Table 3 1×GUS stain formula

[0122]

[0123] Such as Figure 5 As shown, the GUS staining results of LRK2 promoter indicated that LRK2 gene was expressed in tiller buds, nodes, roots and pollen.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of an LRK2 gene or an encoding protein thereof in the promotion of rice tillering, and provides an application of the LRK2 gene or the encoding protein thereof or a recombinant vector containing the LRK2 gene in the promotion of rice tillering. Experiments prove that the recombinant vector containing the LRK2 gene is transferred to rice Nipponbare through an Agrobacterium-mediated method in order to obtain a transgenic rice line, and the tiller number of the obtained transgenic rice line is higher than that of wild rice Nipponbare.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an application of LRK2 gene or its coded protein in promoting rice tillering. Background technique [0002] With the growth of population and the acceleration of urbanization, the area of ​​arable land has been greatly reduced, and the phenomenon of food shortage has become increasingly prominent. Rice is one of the important food crops in my country, and its production is directly related to national security. High yield of rice is an important goal of rice breeding, and it is also one of the current research hotspots. In the late 1950s, dwarf rice was used to breed high-yielding and lodging-resistant varieties, forming the first "green revolution" of rice yield; in the early 1970s, the three lines of hybrid indica rice were successfully matched, forming the second "green revolution". These two breakthroughs in rice yield came from the discovery and utilization of the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/12C12N15/82A01H5/00
Inventor 查笑君康君方高爽田超李健敏陈伟杰
Owner ZHEJIANG NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com