Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

11-type recombinant human papilloma virus virus-like particle and preparation method thereof

A human papillomavirus, tag-hpv11l1 technology, applied in the field of 11 recombinant human papillomavirus virus-like particles and its preparation, can solve the problems of difficult large-scale production application, large protein loss, uneven particles, etc. To achieve the effect of solubility and yield improvement, high expression

Active Publication Date: 2015-10-28
BEIJING HEALTH GUARD BIOTECH
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in these purification processes, the protein loss is large and the yield is low, which makes it difficult to apply in large-scale production.
[0006] In terms of the homogeneity of the HPV vaccine antigen protein VLP, the particle size dispersion of the assembled HPV L1 VLP in the prior art is represented by the polyd value, and the polyd value< 15% indicates that the particles have good uniformity, between 15% and 30% indicates that the particles have relatively large inhomogeneity, and greater than 30% indicates that the particles are not uniform at all
Most HPV L1 VLPs prepared in the prior art are greater than 15%

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 11-type recombinant human papilloma virus virus-like particle and preparation method thereof
  • 11-type recombinant human papilloma virus virus-like particle and preparation method thereof
  • 11-type recombinant human papilloma virus virus-like particle and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment l

[0068] Embodiment 1: the design and synthesis of the HPV L1 gene of codon optimization

[0069] The gene sequences were derived from the various types of HPV sequences published on PUBMED. All HPV DNA sequences were synthesized after codon optimization of the selected HPV DNA sequences according to the codon preference of Escherichia coli for gene transcription. Primers were designed according to the synthetic DNA sequence, and the synthetic gene was used as a template for PCR amplification. The resulting codon-optimized sequences were verified by DNA sequencing.

[0070] DNA sequences of various types of HPV before and after optimization:

[0071] SEQ NO.1: DNA sequence of HPV11 type L1 before optimization

[0072] SEQ NO.2: DNA sequence of optimized HPV11 type L1

Embodiment 2

[0073] Example 2: Construction and identification of recombinant vector pGEX-6P-1-GST-HPV11 L1:

[0074] Primers for amplifying the DNA fragment of HPV11 L1: (the restriction sites are BamHI and XhoI, respectively)

[0075] Forward-HPV11 L1-ApaI:5'ACTTCA GGATCC ATGTGGCGTC CGTCTGACTCTA

[0076] Reverse-HPV11 L1-XhoI:5'ATCTCA CTCGAG CTA TTTTTTGGTT TTGGTACGTTT

[0077] PCR amplification reaction system: 10 x Pfu buffer 20 μL, Pfu enzyme 4 μL, 10 mM dNTP 2.5 μL, 5’ Primer (5 μM) 10 μL, 3’ Primer (5 μM) 10 μL, template DNA 50 ng, add d2H2O to 200 μL.

[0078] Gene PCR amplification conditions: 3 min at 95°C; 30 sec at 95°C, 30 sec at 58°C, 4 min at 72°C; 32 cycles; 10 min at 72°C.

[0079] The L1 gene fragment containing BamH I and XhoI restriction sites and the vector pGEX-6P-1 were subjected to BamH I / XhoI double digestion treatment, and then the recovered gene fragment was combined with pGEX-6P-1 containing the corresponding cohesive end using T4 DNA ligase. 6P-1 was ...

Embodiment 3

[0082] Example 3: Construction of recombinant vector pGEX-6P-1m-GST-SUMO-HPV11 L1 vector

[0083] Construction of pGEX-6p-1m vector: In order to make the ApaI restriction site (GGGCCC) near the multi-restriction site the only ApaI restriction site of the vector, point mutation was carried out without changing the protein expression sequence of the lacI gene ApaI (3890) can be eliminated by changing the Gly codon GGC in another ApaI recognition sequence GGGCCC of the commercially available pGEX-6p-1 vector to its synonymous codon GGT. Through such modification, ApaI can be used to insert and express genes.

[0084] Primers for amplifying the DNA fragment of SUMO: (restriction sites are ApaI and BamHI respectively)

[0085] Forward-SUMO-ApaI: ACTTCA GGGCCC TCTGACCAGGAAGCTAAACCGTC

[0086] Reverse-SUMO-BamHI: CGC GGATCC ACCGGTCTGTTCCTGGTAAAC

[0087] Primers for amplifying the DNA fragment of HPV11 L1: (the restriction sites are BamHI and XhoI, respectively)

[0088] Forw...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to an 11-type recombinant human papilloma virus virus-like particle and its preparation method. The specific technical key point is to provide a new recombinant coded polynucleotide gene fragment of an HPV11 L1 protein, a vector containing the gene fragment, a host cell containing the vector, an HPV11 L1 fusion protein translated and expressed by the gene fragment, a pentamer and VLP composed of the pentamer. The invention also discloses an application of the pentamer, a VLP protein and a vaccine composition composed of the VLP protein in the preparation of drugs for preventing HPV11 infection.

Description

technical field [0001] The invention relates to a virus-like particle of human papilloma virus and a preparation method thereof. More specifically, the present invention relates to a pentamer of recombinant human papillomavirus L1 protein and a virus-like particle (Virus-like Particle, VLP) and a preparation method thereof, and a vaccine composition containing the virus-like particle in Use in the prevention of human papillomavirus infection. Background technique [0002] Human papillomavirus (HPV) mainly through close contact with human body, such as sexually transmitted virus, can cause a variety of human proliferative epithelial lesions, including papilloma (wart) and tumor-like lesions. Specifically, HPV-induced diseases mainly include three categories, the first category: cancers of the cervix, vagina, female vulva, penis and anus, and certain types of malignant lesions such as head and neck tumors. 100% of cervical cancer patients are caused by HPV infection, 90% of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/37C12N15/70C12N1/21C07K19/00C12N7/04C07K14/025A61K39/12A61P31/20
Inventor 许铮刘永江伍树明潘勇昭陈健平高文双银飞陈丹沈迩萃王雅君夏丽任永峰陈小江
Owner BEIJING HEALTH GUARD BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com