A kind of zb transposon system and its mediated gene transfer method
A subsystem and transgenic technology, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve the problem that DNA transposons are rare in vertebrates, and achieve the effect of improving gene transfer efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment I
[0035] The construction of embodiment 1, transposase expression vector pCMV-ZB and transposase in vitro transcription vector pTNT-ZB
[0036] 1. Cloning of ZB transposase coding region (ORF)
[0037] Using zebrafish genomic DNA as a template, the transposase gene fragment was amplified according to the primers listed in Table 1 for amplifying ZB-ORF. The reaction system is 50 μl, 10 μL 5×SF Buffer, 1 μl dNTP, 2 μL 10 μM primer ZB-ORF F, 2 μl 10 μM primer ZB-ORF R (primer sequence: ZB-ORF-F: ttCTCGAGACTAGTgccaccatgatgggtaaaaacaaagaactc (SEQ ID NO.5); ZB-ORF -R: atGGTACCGGGCCCttaatactttgtagaaaagcctt (SEQ ID NO. 6)), 1 μl Phanta TM Super-Fidelity, 1 μl zebrafish genomic DNA template, add ultrapure water to 50 μl (high-fidelity enzyme purchased from Novozyme). PCR amplification program: 94°C for 40s, 55°C for 40s, 72°C for 1m30s, cycle 30 times. PCR amplification products were detected by 1% agarose gel electrophoresis (such as figure 2 ). The agarose gel of the PCR product...
Embodiment II
[0042] Embodiment II, the construction of transposon expression vector
[0043] 1. Construction of transgene donor plasmid pZB-Msc vector
[0044] 1.1 Construction of pT3-PST vector
[0045] PB [2] , SB [1] and Tol2 [3] Plasmid vector as template, clone 5' and 3' transposable elements, primer sequence:
[0046] SBF: ATGgatccattaaatggcgcgccgtttaaaccagttgaagtcggaagttta (SEQ ID NO. 7);
[0047] SBR: GAGgatccattaaatggccggccttaattaacagttgaagtcggaagttta (SEQ ID NO. 8);
[0048] 5'PBF: atggcgcgccttaaccctagaaagatagtctg (SEQ ID NO. 9);
[0049] 5' PBR: acgtttaaac tgatatctataacaagaaaatata (SEQ ID NO. 10);
[0050] 3' PBF: gcttaattaagtttaaactaaaagttttgttactttatagaag (SEQ ID NO. 11);
[0051] 3' PBR: atggccggccttaaccctagaaagataatcatattg (SEQ ID NO. 12);
[0052] 5' Tol2F: CGAAGCTTAGGCCTCAGAGGTGTAAAGTACTTGAGTA (SEQ ID NO. 13);
[0053] 5' Tol2R: GCTTGAATTCCCCGGGGCTAGCAAGTGATCTCCAAAAAATAAGTAC (SEQ ID NO. 14);
[0054] 3' Tol2: GATGGCCATCGCGAGCTAGCAATACTCAAGTACAATTTTAATGGAG (SEQ I...
Embodiment III
[0087] Example III, ZB transposon-mediated target gene expression test at mouse cell level
[0088] 1. Recovery and culture of cryopreserved cells
[0089] The pZB-PGK-NEO and pCMV-ZB plasmids were extracted with the OMEGA endotoxin-free plasmid extraction kit (purchased from OMEGA Company), and the final concentration of the product was adjusted to 500 ng / μL for cell transfection.
[0090] Take out the cryopreservation vials containing mouse embryonic fibroblast MEF (purchased from the Cell Bank of Chinese Academy of Sciences), mouse C2C12 cells and pig PK15 cells from liquid nitrogen, put them into warm water at 37-40°C and shake them quickly until frozen. Completely melt the stock solution; complete rewarming within 1-2min; transfer the cell suspension into a sterile centrifuge tube, add 5mL culture medium, and blow gently; centrifuge the cell suspension at 800-1000rpm for 5min, discard the supernatant; Add 1mL of complete medium to the centrifuge tube containing the cell ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


