Check patentability & draft patents in minutes with Patsnap Eureka AI!

A kind of zb transposon system and its mediated gene transfer method

A subsystem and transgenic technology, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve the problem that DNA transposons are rare in vertebrates, and achieve the effect of improving gene transfer efficiency

Active Publication Date: 2019-05-07
SHANGHAI CELL THERAPY GRP CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] DNA transposon-mediated gene transfer system is a new generation of transgenic technology, but DNA transposons with autonomous transposition activity are rare in vertebrates

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of zb transposon system and its mediated gene transfer method
  • A kind of zb transposon system and its mediated gene transfer method
  • A kind of zb transposon system and its mediated gene transfer method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment I

[0035] The construction of embodiment 1, transposase expression vector pCMV-ZB and transposase in vitro transcription vector pTNT-ZB

[0036] 1. Cloning of ZB transposase coding region (ORF)

[0037] Using zebrafish genomic DNA as a template, the transposase gene fragment was amplified according to the primers listed in Table 1 for amplifying ZB-ORF. The reaction system is 50 μl, 10 μL 5×SF Buffer, 1 μl dNTP, 2 μL 10 μM primer ZB-ORF F, 2 μl 10 μM primer ZB-ORF R (primer sequence: ZB-ORF-F: ttCTCGAGACTAGTgccaccatgatgggtaaaaacaaagaactc (SEQ ID NO.5); ZB-ORF -R: atGGTACCGGGCCCttaatactttgtagaaaagcctt (SEQ ID NO. 6)), 1 μl Phanta TM Super-Fidelity, 1 μl zebrafish genomic DNA template, add ultrapure water to 50 μl (high-fidelity enzyme purchased from Novozyme). PCR amplification program: 94°C for 40s, 55°C for 40s, 72°C for 1m30s, cycle 30 times. PCR amplification products were detected by 1% agarose gel electrophoresis (such as figure 2 ). The agarose gel of the PCR product...

Embodiment II

[0042] Embodiment II, the construction of transposon expression vector

[0043] 1. Construction of transgene donor plasmid pZB-Msc vector

[0044] 1.1 Construction of pT3-PST vector

[0045] PB [2] , SB [1] and Tol2 [3] Plasmid vector as template, clone 5' and 3' transposable elements, primer sequence:

[0046] SBF: ATGgatccattaaatggcgcgccgtttaaaccagttgaagtcggaagttta (SEQ ID NO. 7);

[0047] SBR: GAGgatccattaaatggccggccttaattaacagttgaagtcggaagttta (SEQ ID NO. 8);

[0048] 5'PBF: atggcgcgccttaaccctagaaagatagtctg (SEQ ID NO. 9);

[0049] 5' PBR: acgtttaaac tgatatctataacaagaaaatata (SEQ ID NO. 10);

[0050] 3' PBF: gcttaattaagtttaaactaaaagttttgttactttatagaag (SEQ ID NO. 11);

[0051] 3' PBR: atggccggccttaaccctagaaagataatcatattg (SEQ ID NO. 12);

[0052] 5' Tol2F: CGAAGCTTAGGCCTCAGAGGTGTAAAGTACTTGAGTA (SEQ ID NO. 13);

[0053] 5' Tol2R: GCTTGAATTCCCCGGGGCTAGCAAGTGATCTCCAAAAAATAAGTAC (SEQ ID NO. 14);

[0054] 3' Tol2: GATGGCCATCGCGAGCTAGCAATACTCAAGTACAATTTTAATGGAG (SEQ I...

Embodiment III

[0087] Example III, ZB transposon-mediated target gene expression test at mouse cell level

[0088] 1. Recovery and culture of cryopreserved cells

[0089] The pZB-PGK-NEO and pCMV-ZB plasmids were extracted with the OMEGA endotoxin-free plasmid extraction kit (purchased from OMEGA Company), and the final concentration of the product was adjusted to 500 ng / μL for cell transfection.

[0090] Take out the cryopreservation vials containing mouse embryonic fibroblast MEF (purchased from the Cell Bank of Chinese Academy of Sciences), mouse C2C12 cells and pig PK15 cells from liquid nitrogen, put them into warm water at 37-40°C and shake them quickly until frozen. Completely melt the stock solution; complete rewarming within 1-2min; transfer the cell suspension into a sterile centrifuge tube, add 5mL culture medium, and blow gently; centrifuge the cell suspension at 800-1000rpm for 5min, discard the supernatant; Add 1mL of complete medium to the centrifuge tube containing the cell ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of animal genetic engineering and relates to a zebrafish ZB transposon system and a transgenic method mediated by the ZB transposon system, which is derived from zebrafish and contains two terminal repeats that can be inserted into a target gene cassette The transgene donor plasmid of sequence and the transposase auxiliary plasmid providing transposition activity; the transgene donor plasmid includes the flanking terminal repeat sequence of the zebrafish ZB transposon and the Msc1 insertion cloning site. Also disclosed is a gene transfer method based on the ZB transposon system, which is to introduce the target gene into the recipient genome through the ZB transposon system. The present invention can be applied to multiple biotechnology fields: 1) The method provided in the present invention can be used to effectively insert the target gene cassette into the host genome to improve the efficiency of gene transfer; 2) Combined with gene capture technology, it can effectively carry out animal Gene function research; 3) It can mediate human gene therapy, etc.

Description

technical field [0001] The invention relates to the establishment of a transgenic method mediated by the zebrafish ZB transposon system, and also discloses a method for constructing a transgene donor plasmid and a transposase eukaryotic expression and in vitro transcription auxiliary plasmid involved in the method, and Application in preparation of transgenic animals, research on gene function and human gene therapy. The invention belongs to the field of animal genetic engineering. Background technique [0002] Gene transfer is an important biotechnology method at present, and has important application value in the fields of studying gene function, preparing transgenic organisms and gene therapy. [0003] Transposons are a type of mobile DNA sequences that can freely jump (replicate or translocate) on the genome. They were first discovered by Mc. found in species. Scientists have developed and perfected the method of transposon-mediated cytoplasmic microinjection by takin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N15/54
Inventor 高波沈丹宋成义钱跃薛松磊王赛赛
Owner SHANGHAI CELL THERAPY GRP CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More