Method for maintaining and breeding maze male sterile line constructed on basis of Ms30 gene

A male sterility and corn technology, applied in the fields of molecular biology and plant genetic engineering, can solve problems such as incompleteness, economic loss, and inability of homozygous nuclear males to reproduce and maintain

Active Publication Date: 2015-11-11
BEIJING SHOU JIA LI HUA SCI TECH CO LTD +1
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Artificial detasseling is relatively easy, and mechanical detasseling and chemical detasseling can also be used. However, these strategies also have some problems: on the one hand, these techniques greatly increase the cost of seed production; Thorough or untimely, it will reduce the purity of hybrids, resulting in a large area of ​​production reduction, and ultimately lead to great economic losses
[0003] Maize nuclear male sterile material is a precious germplasm resource, which is of great significance to the production of maize hybrids. is hardly used effectively
With the continuous d

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for maintaining and breeding maze male sterile line constructed on basis of Ms30 gene
  • Method for maintaining and breeding maze male sterile line constructed on basis of Ms30 gene
  • Method for maintaining and breeding maze male sterile line constructed on basis of Ms30 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Construction of multiple control sterile vectors pMCS3001, pMCS3002 and pMCS3003

[0051] 1. Construction of multi-control sterile vector pMCS3001 containing 4 expression cassettes

[0052] 1) An intermediate vector pCLC containing the expression cassette of the fluorescent protein marker gene mCherry (Ltp2: mCherry, SEQ ID NO. 1) and the expression cassette of the herbicide resistance gene Bar (CaMV35SPRO: Bar, SEQ ID NO. 2) was constructed.

[0053] The Ltp2 fragment was amplified using pMD18-Ltp2 as the template, and the primers used were:

[0054] oligo01: 5'-ca aagctt ctctagaactagtggatctcgatgtgtag (AAGCTT is HindIII restriction site);

[0055] oligo02: 5'-ct ggtcaccagatct tactcggctacactcacac (GGTCACC is the BstEII restriction site, AGATCT is the BglII restriction site).

[0056] pCambia3301 is one of the pCambia series vectors, containing the expression cassette of the herbicide resistance gene Bar. The Ltp2 fragment of the above amplificati...

Embodiment 2

[0110] Example 2: Application of corn multi-control sterile vectors pMCS03001, pMCS3002 and pMCS3003

[0111] 1. Transforming Agrobacterium with corn multi-control sterile vector

[0112] Referring to the method of AN (Methods in Enzymology (1987) 153: 292-305), the multi-control sterile vectors pMCS3001, pMCS3002 and pMCS3003 constructed in the present invention were transformed into Agrobacterium EHA105 (Hoodetal., Transgenic Res (1993) 2: 208-218) middle.

[0113] Take 1-2 μg of plasmid, add it to 100 μL of Agrobacterium EHA105 competent cells dissolved on ice, and take an ice bath for 30 min. Quickly freeze in liquid nitrogen for 1 minute, transfer to 37°C water bath for 5 minutes; add 1000 μL YEB liquid medium after rapid ice bath for 2 minutes, incubate at 28°C at 200rpm for 2~4hrs, and coat with 50mg / L Rifampicin and 100 mg / L kanamycin were cultured on solid YEB plates for 2 to 3 days. After a single colony was grown, a single colony was picked and inoculated int...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a multi-control sterile carrier constructed on basis of an Ms30 gene and used for restoring, maintaining and breeding a maze male sterile line and its application method and belongs to the field of biotech genetic engineering. The multi-control sterile carrier comprises four functional gene elements: a maze male sterile fertility restoration functional gene (1), a maze male gametophyte formation preventive functional gene (2), a corn peel color screening mark functional gene (3), and an herbicide resistance functional gene element (4). Such a construction can be introduced into a maze acceptor (such as a cell, callus or organ) to restore, maintain and breed the maze male sterile line corresponding to the Ms30 gene. The method is expected to be applicable to novel sterile hybridization and hybrid seed production of maize and has great application value in maize production.

Description

technical field [0001] Generally, the present invention is in the fields of molecular biology and plant genetic engineering. Specifically, the present invention relates to a fertility restorer gene for restoring male sterile maize fertility Ms30 The construct, the recombinant vector comprising the construct, and the host cell transformed with the construct or the recombinant vector, the transgenic plant cell and the preparation method of transgenic corn, and the maize male sterile line seed and maintainer line produced therefrom seed. Background technique [0002] The utilization of crop heterosis and hybrid breeding technology is an effective means to improve crop yield and quality and ensure national food security. Maize is a model of heterosis utilization, in which the key to hybrid breeding and seed production technology lies in the emasculation of the female parent. Artificial detasseling is relatively easy, and mechanical detasseling and chemical detasseling can als...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/11C12N15/82C12N5/10A01H1/02
Inventor 万向元谢科吴锁伟安学丽李金萍张丹凤刘慎思肖中华
Owner BEIJING SHOU JIA LI HUA SCI TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap