Method for maintaining and breeding maze male sterile line constructed on basis of Ms30 gene
A male sterility and corn technology, applied in the fields of molecular biology and plant genetic engineering, can solve problems such as incompleteness, economic loss, and inability of homozygous nuclear males to reproduce and maintain
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1: Construction of multiple control sterile vectors pMCS3001, pMCS3002 and pMCS3003
[0051] 1. Construction of multi-control sterile vector pMCS3001 containing 4 expression cassettes
[0052] 1) An intermediate vector pCLC containing the expression cassette of the fluorescent protein marker gene mCherry (Ltp2: mCherry, SEQ ID NO. 1) and the expression cassette of the herbicide resistance gene Bar (CaMV35SPRO: Bar, SEQ ID NO. 2) was constructed.
[0053] The Ltp2 fragment was amplified using pMD18-Ltp2 as the template, and the primers used were:
[0054] oligo01: 5'-ca aagctt ctctagaactagtggatctcgatgtgtag (AAGCTT is HindIII restriction site);
[0055] oligo02: 5'-ct ggtcaccagatct tactcggctacactcacac (GGTCACC is the BstEII restriction site, AGATCT is the BglII restriction site).
[0056] pCambia3301 is one of the pCambia series vectors, containing the expression cassette of the herbicide resistance gene Bar. The Ltp2 fragment of the above amplificati...
Embodiment 2
[0110] Example 2: Application of corn multi-control sterile vectors pMCS03001, pMCS3002 and pMCS3003
[0111] 1. Transforming Agrobacterium with corn multi-control sterile vector
[0112] Referring to the method of AN (Methods in Enzymology (1987) 153: 292-305), the multi-control sterile vectors pMCS3001, pMCS3002 and pMCS3003 constructed in the present invention were transformed into Agrobacterium EHA105 (Hoodetal., Transgenic Res (1993) 2: 208-218) middle.
[0113] Take 1-2 μg of plasmid, add it to 100 μL of Agrobacterium EHA105 competent cells dissolved on ice, and take an ice bath for 30 min. Quickly freeze in liquid nitrogen for 1 minute, transfer to 37°C water bath for 5 minutes; add 1000 μL YEB liquid medium after rapid ice bath for 2 minutes, incubate at 28°C at 200rpm for 2~4hrs, and coat with 50mg / L Rifampicin and 100 mg / L kanamycin were cultured on solid YEB plates for 2 to 3 days. After a single colony was grown, a single colony was picked and inoculated int...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap