Lactobacillus bacterial strain capable of expressing and secreting human interferon Alpha2b and application thereof

A Lactobacillus, expression cassette technology, applied in the field of molecular biology, can solve the problems of high drug dosage, high drug storage conditions, etc.

Inactive Publication Date: 2015-11-25
SUZHOU OSEL BIO PHARM
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These treatments often require high drug doses, stri

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactobacillus bacterial strain capable of expressing and secreting human interferon Alpha2b and application thereof
  • Lactobacillus bacterial strain capable of expressing and secreting human interferon Alpha2b and application thereof
  • Lactobacillus bacterial strain capable of expressing and secreting human interferon Alpha2b and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0030] Strains and Cultures

[0031] Human vaginal isolate 1153 of Lactobacillus jansii was incubated in MRS broth (Difco, Detroit, MI) at 37°C (5% CO 2 ) under cultivation. For protein expression analysis, Rogosa SL broth medium (Difco, Detroit, MI) was used. Plasmids were introduced into L. jansnii 1153 by electroporation as described [Changetal, 2003]. To maintain the plasmid, transformed E. coli Novablue (invitrogen) was cultured at 37°C in LB broth medium (Difco) supplemented with erythromycin (200 μg / ml).

[0032] Construction of human IFN-α2b expression plasmid.

[0033] In order to produce secreted IFN-α2b protein in Lactobacillus jansnii strain 1153, pSC / IFN-α2b (Chen Hui, et al., 2004, Expression and identification of human interferonin α2b gene in Lactobacillus delbrueckii. China Microbiology Journal of Ecology, 16:128-31) as template, using primer INF5'(AT GCTAGC TGTGACCTGCCGCAGACCCACT (SeqIDNo: 3), the underline is the NheI site) and INF3'-2 (AT CAATTG TTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Symbiotic bacteria generally mainly producing Lactobacillus bacteria producing H2O2 are distributed on vaginal mucosa of a healthy woman of childbearing age, and the Lactobacillus bacteria functions in protectively preventing urinary and reproductive system infections. Multiple Lactobacillus bacteria are already provided with resistance to, for example, HIV virus by bioengineering so as to prevent the urinary and reproductive system infections. Lactobacillus jensenii producing H2O2, a principle member in the vaginal microbial flora, is reconstructed by bioengineering, so that the Lactobacillus jensenii is enabled to produce and secrete a powerful broad-spectrum antiviral molecule, human IFN Alpha-2b.

Description

technical field [0001] The invention relates to the field of molecular biology, and more specifically relates to an expression plasmid of human interferon alpha 2b and a genetically engineered bacterial strain expressing the protein. Background technique [0002] Most viruses, including human papillomavirus (HPV) and human herpes simplex virus (HSV), usually invade the host at mucosal surfaces. HPV infection has become a worldwide epidemic, with more than 6 million new cases each year in the United States alone. Every year millions of women worldwide are found to have potentially precancerous, abnormal Pap smears associated with HPV infection. For cervical lesions associated with HPV infection, there is no feasible drug treatment. Instead, efforts have been made to perform surgical or other excisional techniques to destroy the infected tissue and prevent further disease progression. These practices are usually restricted to more advanced patients due to undesired side eff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/74C12N1/21A61K38/21A61K9/02A61K9/48A61K9/00A61K39/39A61P31/20A61P31/22A61P35/00C12R1/225
Inventor 刘阳张智清李皮特
Owner SUZHOU OSEL BIO PHARM
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products