Lactobacillus bacterial strain capable of expressing and secreting human interferon Alpha2b and application thereof
A Lactobacillus, expression cassette technology, applied in the field of molecular biology, can solve the problems of high drug dosage, high drug storage conditions, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0030] Strains and Cultures
[0031] Human vaginal isolate 1153 of Lactobacillus jansii was incubated in MRS broth (Difco, Detroit, MI) at 37°C (5% CO 2 ) under cultivation. For protein expression analysis, Rogosa SL broth medium (Difco, Detroit, MI) was used. Plasmids were introduced into L. jansnii 1153 by electroporation as described [Changetal, 2003]. To maintain the plasmid, transformed E. coli Novablue (invitrogen) was cultured at 37°C in LB broth medium (Difco) supplemented with erythromycin (200 μg / ml).
[0032] Construction of human IFN-α2b expression plasmid.
[0033] In order to produce secreted IFN-α2b protein in Lactobacillus jansnii strain 1153, pSC / IFN-α2b (Chen Hui, et al., 2004, Expression and identification of human interferonin α2b gene in Lactobacillus delbrueckii. China Microbiology Journal of Ecology, 16:128-31) as template, using primer INF5'(AT GCTAGC TGTGACCTGCCGCAGACCCACT (SeqIDNo: 3), the underline is the NheI site) and INF3'-2 (AT CAATTG TTA...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com