Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A Streptomyces flavinus and its application in greenhouse soil remediation

A kind of Streptomyces flavus, greenhouse technology, applied in the restoration of polluted soil, bacteria, fungi and other directions, to achieve strong growth and reproduction ability, stable genetic characteristics, and solve the effect of secondary salinization

Active Publication Date: 2018-08-28
新疆惠森生物技术有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Regarding the isolation and screening of strains that can improve greenhouse soil from greenhouse soil, and the use of self-selection to screen domesticated Streptomyces flavinus and other multi-strain basic requirements based on the compatibility, applicability and safety of strains There is no report on the preparation of soil remediation agent for the improvement of greenhouse soil

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Streptomyces flavinus and its application in greenhouse soil remediation
  • A Streptomyces flavinus and its application in greenhouse soil remediation
  • A Streptomyces flavinus and its application in greenhouse soil remediation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Isolation, screening and identification of Streptomyces microflavus XHS0032Xh CGMCC NO.9432

[0030] 1. Isolation and screening of strains

[0031] (1) Separation

[0032] The Streptomyces flavinus used in the present invention is sampled and isolated from typical greenhouse soils with severe salinization, soil desertification or compaction in Korla, southern Xinjiang, and is initially screened out according to the antagonism mechanism analysis of the strains to the greenhouse soil. Strains with certain antagonistic ability to soil problems such as soil salinization and soil compaction. Use the traditional plate culture method to isolate the microorganisms in the soil layer, purify the strains by the plate streak method, and use different culture temperatures, pH values, and medium as enrichment conditions to screen out a batch of well-growing microbial strains, and select one of them The bacterial strain whose serial number is XHS0032Xh.

[0033] Separati...

Embodiment 2

[0039] Embodiment two: the growth factor of Streptomyces microflavus (Streptomyces microflavus) XHS0032Xh CGMCC NO.9432

[0040] 1. Salt tolerance test

[0041] To identify the salt tolerance of the bacteria, it is required to inoculate the IPS2 medium, add NaCl at a concentration of 0mol / L, 0.5mol / L, 1.0mol / L, and 1.5mol / L and culture at 30°C for 2-5d to observe the growth.

[0042] Experimental results: the bacteria did not grow when the concentration of NaCI was 1-1.5mol / L, and it grew well without adding NaCI to the medium. See attached figure 1 .

[0043] 2. Gelatin liquefaction experiment

[0044] Gelatin is an animal protein. The hydrolysis of gelatin is due to the fact that some bacteria have gelatinase, which can first hydrolyze gelatin into polypeptides, further hydrolyze into amino acids, lose gel properties and liquefy. The gelatin medium itself solidifies below 20°C and liquefies itself above 24°C. After gelatin decomposes, its molecules become smaller, and i...

Embodiment 3

[0064] Example 3: Molecular level of Streptomyces microflavus XHS0032Xh CGMCC NO.9432

[0065] 1. PCR amplification of the 16S rDNA sequence of Streptomyces flavinus and its sequencing

[0066] Pick a small amount of single colonies of the XHS0032Xh strain, put them into an EP tube filled with 25 μL of sterile water, boil at 100°C for 8-10 minutes, and then quickly put them into the ice-water mixture for 5 minutes. Centrifuge at 10000r / min for 5min, store at 4°C, and take the supernatant when used.

[0067] Determination of 16S rDNA gene sequence and construction of phylogenetic tree: Extract the total DNA of the strain according to conventional methods, dilute the universal primer with deionized water, and perform PCR amplification. The primer design is as follows:

[0068] 27f:AGAGTTTGATCCTGGCTCAG

[0069] 1492r:TACGGCTACCTTGTTACGACTT

[0070] Determination of 16S rRNA gene sequence and construction of phylogenetic tree: extract the total DNA of the strain according to co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses streptomyces microflavus and application thereof in greenhouse soil remediation. By carrying out strain isolating, screening, breeding and domesticating on a greenhouse soil sample as well as through 16S rDNA sequencing and phylogenetic analysis, 70-85 parts of streptomyces microflavus XHS0032Xh CGMCC NO.9432 which is numbered as XHS0032Xh, 20-35 parts of micrococcus luteus, 25-40 parts of bacillus pasteurii and 15-30 parts of candida tropicalis are mixed, and a mixed strain liquid is fully adsorbed in a carrier and is mixed with accessories; a greenhouse soil remediation compound is prepared by virtue of a fermentation technology; and the soil remediation compound has an outstanding technical effect in greenhouse soil remediation.

Description

technical field [0001] The invention relates to the technical field of application of agricultural microorganisms, in particular to the technical field of self-selected and screened Streptomyces flavinus and its application in greenhouse soil restoration. Background technique [0002] In recent years, with the rapid development of modern agriculture in my country, the cultivation area of ​​greenhouse vegetables, fruits, flowers, etc. has been continuously expanded. However, many problems have been brought about. The continuous accumulation of raw salt and the increasingly serious salinization lead to low yield and poor quality of agricultural and sideline products such as vegetables and fruits. At the same time, in order to quickly recover the cost and create more benefits, the growers of the greenhouse grow various crops continuously, so that the land in the greenhouse cannot get any leisure, and the soil fertility is seriously reduced. The use of inorganic fertilizers alone...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20C12N1/16B09C1/10C12R1/465C12R1/265C12R1/07C12R1/74
Inventor 王心歌张松林韩友青
Owner 新疆惠森生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com