A Fluorescence Quantitative PCR Detection Method of Xijiang Virus Sybr Green I

A fluorescence quantitative and Xijiang virus technology, applied in biochemical equipment and methods, microbiological measurement/inspection, etc., can solve the problems of no patent publication of Xijiang virus detection technology, and achieve improved sensitivity, high sensitivity, and simple operation Effect

Active Publication Date: 2019-09-06
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] After searching the literature of the existing technology, it was found that there is no patent publication of Xijiang virus detection technology in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Fluorescence Quantitative PCR Detection Method of Xijiang Virus Sybr Green I
  • A Fluorescence Quantitative PCR Detection Method of Xijiang Virus Sybr Green I
  • A Fluorescence Quantitative PCR Detection Method of Xijiang Virus Sybr Green I

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0028] Specific embodiment one: a kind of Xijiang virus SYBR Green I fluorescent quantitative PCR detection method of the present embodiment, it is carried out according to the following steps:

[0029] 1. Design of XRV SYBR Green Ⅰ fluorescent quantitative PCR primers

[0030] According to the sequence of the XRV S1 gene, sequence comparison was performed by the software clustalx1.81 to determine the specific sequence region of the XRV gene, and fluorescent quantitative primers specific for XRV were designed in this region; the primer sequences are as follows:

[0031] XRV-F: 5'CTAACTCCGCTGACACGA 3';

[0032] XRV-R: 5'CAAACACTATTGACGCACAT 3';

[0033] 2. Construction of standard curve

[0034] According to the primers designed in step 1, the full-length XRV S1 gene cDNA was used as a template to carry out fluorescent quantitative amplification, and draw a fluorescent quantitative standard curve;

[0035] 3. Experimental establishment standards

[0036] If the blank contro...

specific Embodiment approach 2

[0039] Embodiment 2: The difference between this embodiment and Embodiment 1 is that the reaction system of fluorescent quantitative PCR is 25 μl, and the specific components are:

[0040]

[0041] The fluorescent quantitative PCR reaction program was as follows: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 10 sec, annealing and extension at 60°C for 20 sec, and fluorescence signal collection, a total of 40 cycles.

[0042] Others are the same as in the first embodiment.

specific Embodiment approach 3

[0043] Embodiment 3: This embodiment is different from Embodiment 1 in that: the full-length S1 gene cDNA of XRV is obtained by reverse transcription of the full-length S1 gene DNA of XRV. Others are the same as in the first embodiment.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relate to a method for detecting XRV through an SYBR Green I fluorogenic quantitative PCR. The method aims at solving the problem that in the prior art, a method for detecting the XRV through a fluorogenic quantitative PCR is not available. The method comprises the steps that firstly, a primer is designed; secondly, a standard curve is structured; thirdly, negative and positive judgment is carried out. The detection sensitivity of the method can reach 100 copied virus RNA molecules, a single sample can be detected within two hours, operation is easy, and high flux sample detection can be carried out.

Description

technical field [0001] The invention relates to a SYBR Green I fluorescent quantitative PCR detection method for Xijiang virus, relates to a SYBR Green I fluorescent quantitative PCR general detection method for detecting bat-derived Huchanggu Xijiang virus, and belongs to the technical field of molecular bioengineering. Background technique [0002] Xijiang virus is a virus that can produce cell syncytia isolated from the lungs of bats in 2006. After preliminary morphological identification, nucleic acid electrophoresis identification, and partial segmental nucleotide sequence identification, the virus belongs to Orthoreovirus Nelson A new member of the Gulfvirus genus, named Xijiang virus (isolated from the Xijiang River Basin of Guangdong Province, my country) (XRV) according to the naming convention of Nelson's Gulf virus, this is the first bat reosteroid found in my country so far Virus. [0003] The Reoviridae family is an important group of viruses closely related to r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/70C12Q1/6851
Inventor朱妍史子学李素潘铁骊韩彩霞盛尊来张萍
OwnerNORTHEAST AGRICULTURAL UNIVERSITY