Constant-temperature detecting method for fusobacterium nucleatum, as well as special primer and kit thereof
A Fusobacterium nucleatum and kit technology, applied in the biological field, can solve the problems of the LAMP-specific primers and kits for Fusobacterium nucleatum, and achieve the effect of being suitable for large-scale promotion and application, broad market prospects, and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1. Primer Design for LAMP Detection of Fusobacterium nucleatum
[0049] The Fusobacterium nucleatum sequence (GenBank number: CP007062.1) was retrieved from the American Gene Database, and the homology analysis was performed by BLAST software to obtain the specific conserved target sequence NusG gene of Fusobacterium nucleatum (sequence 1 in the sequence table). Then, according to the conserved target DNA sequence, the primers for LAMP detection of Fusobacterium nucleatum were designed with the software PrimerdesignV4, and the optimal set of primers was optimized as a result. The specific primer sequences are shown in Table 1.
[0050] Table 1 Primers used for LAMP detection of Fusobacterium nucleatum
[0051] Primer name
[0052] The above sequence 2-sequence 6 were artificially synthesized.
Embodiment 2
[0053] Embodiment 2, the establishment of the LAMP detection method of Fusobacterium nucleatum of the present invention
[0054] Use the five primers obtained in Example 1 for the LAMP detection of Fusobacterium nucleatum (from the Infectious Disease Control Center of the Chinese People's Liberation Army's Center for Disease Control and Prevention, isolated from clinical samples) to perform LAMP detection to obtain Optimal reaction system and reaction condition, concrete method is as follows:
[0055] 1. Determination of the best reaction primers
[0056] Under the same reaction conditions (at 63°C for 50 minutes), different primer combinations C1, C2, C3, C4, and C5 were added to the reaction system to determine the best reaction primers. The primer combinations are shown in Table 2:
[0057] Table 2
[0058] C5F3
CCTACAAATCCAGTAACTCCAT
C5B3
ACATTAGGTTTTTAGAGAAGTTGT
C5FIP
ACAAGAGAAGAAAATGAACAGGGTTTTGGTATTTCTTACTTCATACCATAC
C5BIP
...
Embodiment 3
[0076] Example 3, the specificity and sensitivity detection of the LAMP detection method of Fusobacterium nucleatum of the present invention
[0077] The primers shown in Table 1 were used.
[0078] One, the specific detection of the LAMP detection method of Fusobacterium nucleatum of the present invention
[0079] 1. LAMP reaction
[0080] Template preparation: Genomic DNA extracted from the following strains: L1: Fusobacterium nucleatum subsp. Nucleatum, 1,; L2: Lactobacillus salivarius; L3: NS; L4: Lactobacillus salivarius; L5: Streptococcusmutans; L6: Humanbloodgenome; L7: Klebsiellapneumonia; ;L10:Lactobacillusrhamnosus;L11:Humanbloodgenome;L12:Staphylococcusepidermidis;L13:Staphylococcusaureus;L14:Streptococcusalactolyticus;L15:Streptococcusthermophilus;L16:Lactobacillusplantarum;L17:Micrococcusluteus;L18:Lactobacilluscasei;L19:Lactobacillusfermentum;L20:Streptococcussanguis;L21:Streptococcusalactolyticus;
[0081] LAMP reaction system: the best detection system determ...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com