Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Constant-temperature detecting method for fusobacterium nucleatum, as well as special primer and kit thereof

A Fusobacterium nucleatum and kit technology, applied in the biological field, can solve the problems of the LAMP-specific primers and kits for Fusobacterium nucleatum, and achieve the effect of being suitable for large-scale promotion and application, broad market prospects, and simple operation

Inactive Publication Date: 2016-01-20
INST OF PLA FOR DISEASE CONTROL & PREVENTION
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there are no LAMP-specific primers and kits for detecting Fusobacterium nucleatum on the market.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Constant-temperature detecting method for fusobacterium nucleatum, as well as special primer and kit thereof
  • Constant-temperature detecting method for fusobacterium nucleatum, as well as special primer and kit thereof
  • Constant-temperature detecting method for fusobacterium nucleatum, as well as special primer and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1. Primer Design for LAMP Detection of Fusobacterium nucleatum

[0049] The Fusobacterium nucleatum sequence (GenBank number: CP007062.1) was retrieved from the American Gene Database, and the homology analysis was performed by BLAST software to obtain the specific conserved target sequence NusG gene of Fusobacterium nucleatum (sequence 1 in the sequence table). Then, according to the conserved target DNA sequence, the primers for LAMP detection of Fusobacterium nucleatum were designed with the software PrimerdesignV4, and the optimal set of primers was optimized as a result. The specific primer sequences are shown in Table 1.

[0050] Table 1 Primers used for LAMP detection of Fusobacterium nucleatum

[0051] Primer name

[0052] The above sequence 2-sequence 6 were artificially synthesized.

Embodiment 2

[0053] Embodiment 2, the establishment of the LAMP detection method of Fusobacterium nucleatum of the present invention

[0054] Use the five primers obtained in Example 1 for the LAMP detection of Fusobacterium nucleatum (from the Infectious Disease Control Center of the Chinese People's Liberation Army's Center for Disease Control and Prevention, isolated from clinical samples) to perform LAMP detection to obtain Optimal reaction system and reaction condition, concrete method is as follows:

[0055] 1. Determination of the best reaction primers

[0056] Under the same reaction conditions (at 63°C for 50 minutes), different primer combinations C1, C2, C3, C4, and C5 were added to the reaction system to determine the best reaction primers. The primer combinations are shown in Table 2:

[0057] Table 2

[0058] C5F3

CCTACAAATCCAGTAACTCCAT

C5B3

ACATTAGGTTTTTAGAGAAGTTGT

C5FIP

ACAAGAGAAGAAAATGAACAGGGTTTTGGTATTTCTTACTTCATACCATAC

C5BIP

...

Embodiment 3

[0076] Example 3, the specificity and sensitivity detection of the LAMP detection method of Fusobacterium nucleatum of the present invention

[0077] The primers shown in Table 1 were used.

[0078] One, the specific detection of the LAMP detection method of Fusobacterium nucleatum of the present invention

[0079] 1. LAMP reaction

[0080] Template preparation: Genomic DNA extracted from the following strains: L1: Fusobacterium nucleatum subsp. Nucleatum, 1,; L2: Lactobacillus salivarius; L3: NS; L4: Lactobacillus salivarius; L5: Streptococcusmutans; L6: Humanbloodgenome; L7: Klebsiellapneumonia; ;L10:Lactobacillusrhamnosus;L11:Humanbloodgenome;L12:Staphylococcusepidermidis;L13:Staphylococcusaureus;L14:Streptococcusalactolyticus;L15:Streptococcusthermophilus;L16:Lactobacillusplantarum;L17:Micrococcusluteus;L18:Lactobacilluscasei;L19:Lactobacillusfermentum;L20:Streptococcussanguis;L21:Streptococcusalactolyticus;

[0081] LAMP reaction system: the best detection system determ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a constant-temperature detecting method for fusobacterium nucleatum, as well as a special primer and a kit thereof. The invention provides a circular mediate constant-temperature amplification primer for detecting the fusobacterium nucleatum, which is composed of a primer 1, a primer 2, a primer 3, a primer 4 and a primer 5, wherein the sequence 2, sequence 3, sequence 4, sequence 5 and sequence 6 in a sequence table are respectively taken as the nucleotide sequences of the primer 1, the primer 2, the primer 3, the primer 4 and the primer 5. According to the constant-temperature detecting method provided by the invention, the fusobacterium nucleatum can be quickly, conveniently, efficiently, high-peculiarly and high-sensitively detected under a constant temperature condition; no complex instrument is required; a new technical platform is supplied for detecting the fusobacterium nucleatum; the constant-temperature detecting method can be used for screening and detecting the fusobacterium nucleatum for the basic medical treatment enterprises and various disease control and prevention centers; the constant-temperature detecting method has wide market prospect, has higher economic and social benefits and is suitable for wide-scope popularization and application.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a molecular biology detection method of bacteria, in particular to a LAMP detection method of Fusobacterium nucleatum and its special primers and kit. Background technique [0002] Fusobacterium nucleatum (F.nucleatum) is a Gram-negative obligate anaerobic bacterium that participates in the inflammatory response of periodontal disease and is often isolated from subgingival plaque. It is a microorganism that plays a leading role in periodontal disease. One of the suspected pathogens of adult periodontitis and juvenile periodontitis. In addition to causing oral disease, the bacteria can cause infections in other parts of the body, including the brain, lungs and liver, blood and joints, chest and abdomen. Fusobacterium nucleatum is also a common anaerobic bacteria in intrauterine infection, which can be detected in the amniotic fluid of pregnant women with premature labor and intact fe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/6844C12Q1/689C12Q2531/119
Inventor 黄留玉刘威黄思妺邹大阳董德荣杨展刘宁伟杨文超贺晓明敖大徐雅晴唐玥马文秦日辉
Owner INST OF PLA FOR DISEASE CONTROL & PREVENTION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com