Unlock instant, AI-driven research and patent intelligence for your innovation.

Reagent kit for Coxsackie virus CA10 type fluorescent quantitative PCR detection

A detection kit and coxsackie virus technology, applied in the direction of microbiological determination/testing, microbiology, biochemical equipment and methods, etc., to achieve good specificity

Inactive Publication Date: 2016-02-17
SANSURE BIOTECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The purpose of the present invention is to solve the defects of the existing Coxsackievirus CA10 type nucleic acid fluorescent quantitative PCR detection kit, and provide a kind of rapid operation, simple and convenient method, high detection sensitivity, wide detection range and accurate Coxsackievirus CA10 type nucleic acid Fluorescent quantitative PCR detection kit, which can quantitatively analyze Coxsackievirus CA10 in human serum or throat swab or herpes exudate, etc. The test results can be used for auxiliary diagnosis and disease of Coxsackievirus CA10 infection monitor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent kit for Coxsackie virus CA10 type fluorescent quantitative PCR detection
  • Reagent kit for Coxsackie virus CA10 type fluorescent quantitative PCR detection
  • Reagent kit for Coxsackie virus CA10 type fluorescent quantitative PCR detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] This embodiment provides a Coxsackievirus CA10 type fluorescent quantitative PCR detection kit, which includes the following components: RNA extraction solution, RNA eluent, RT-PCR enhancer, internal standard, PCR reaction solution, CA10 positive Reference substance, CA10 negative control substance, wherein, the internal standard is a recombinant of a 320 base pair artificially synthesized DNA sequence inserted into the pUC18T vector, and the concentration is 1.00E+04copies / ml~5.00E+04copies / ml ; The sequence of 128 base pairs is as follows:

[0058] 5'-GTCCAGTACTTTCAAAGCTCGATCCCGGTAACTACCAAATCGGTACGTACCGGTTTAAAACCACCGATCGCCTCTTCCCAACCTGTACGTACGTACGTACGTCCAAAAGTTTCCACGTACGATCGATC-3'.

[0059] The RNA extraction solution comprises the following components:

[0060] RNA extraction solution I: sodium dodecyl sulfate, mass / volume 0.2%~1.0%, triton, volume / volume 1.0%~4.0%, guanidine isothiocyanate 0.2mol / L~1.0mol / L, 100μg / ml~400μg / ml magnetic beads;

[0061] RNA extract...

Embodiment 2

[0103] This embodiment provides a Coxsackievirus CA10 type fluorescent quantitative PCR detection kit, which is composed of the same kit as in Example 1, and the detection steps and methods are also the same as in Example 1, and is used to detect and detect other hand-foot-mouth viruses and Enteroviruses, as a result of image 3 Shown in the figure is the background noise peak of the amplified non-CA10 virus.

[0104] Depend on image 3 The analysis shows that this kit has no amplification curve for normal human throat swab samples, or CA16, CA6, CA7, CA9, CB2, CB5, CBl3, ECH019 and EV71 infected samples, and the test results are all negative, and the negative coincidence rate is 100%, indicating that the kit has good specificity and high accuracy.

Embodiment 3

[0106] This embodiment provides a Coxsackievirus CA10 type fluorescence quantitative PCR detection kit, its composition is the same as the kit in Example 1, and the detection steps and methods are also the same as in Example 1, the internal standard amplification curve of the kit Figure such as Figure 4 As shown, it shows that the PNA extraction and amplification method of the detection kit provided in this embodiment will not produce substances that inhibit the specific PCR reaction, and can effectively monitor the reaction.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Amplification efficiencyaaaaaaaaaa
Login to View More

Abstract

The embodiment of the invention discloses a reagent kit for Coxsackie virus CA10 type fluorescent quantitative PCR detection. The reagent kit comprises an RNA extraction solution, RNA eluant, an RT-PCR reinforcing agent, an internal label, a PCR reaction solution, a CA10 positive reference substance and a CA10 negative reference substance. By means of the reagent kit for Coxsackie virus CA10 type fluorescent quantitative PCR detection, only CA10-RNA can be detected, and other pathogene RNA can not be detected. Besides, detection sensitivity, accuracy and stability are high, detection sensitivity can reach 50 copie / ml, the detection range ranges from 5.00E+01 to 5.00E+09 copies / ml, and reliable experiment evidences are provided for early diagnosis of Coxsackie virus CA10 type infection.

Description

technical field [0001] The invention relates to a nucleic acid fluorescent PCR detection kit, in particular to a Saatchie virus CA10 type fluorescent quantitative PCR detection kit, which belongs to the field of in vitro diagnosis of hand, foot and mouth disease. Background technique [0002] Hand, foot and mouth disease (hand.foot-mouth disease) is a common disease in children prevalent in the world, mainly occurs in children under 3 years old, but there are occasional reports of adult onset, it is caused by a variety of enteroviruses, with fever and hand Herpes is the main feature of herpes, feet, mouth and other parts of the disease, a small number of affected children may develop encephalitis, acute flaccid paralysis, myocarditis, cerebral edema and other serious complications, the disease progresses rapidly, and severe cases may lead to death. In recent years, HFMD has occurred in many countries, especially in the Asia-Pacific region, and has attracted more and more att...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/6851C12Q1/6806C12Q1/701C12Q2531/113C12Q2545/101C12Q2563/107C12Q2523/308
Inventor 戴立忠丁海周雷刘佳
Owner SANSURE BIOTECH