Molecular identification method of Dian-type I three-line hybrid Japonica rice sterile line
A hybrid japonica rice and molecular identification technology, which is applied in the field of molecular identification of the sterile line of a three-line hybrid japonica rice in Yunnan, can solve the problems such as the accuracy rate falling to 80%, the research on sterile genes is lagging behind and declining, and achieving accurate identification, The effect of precise molecular positioning and simple method of fertility gene
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0024] In order to further illustrate the molecular identification method of the present invention for the Dian-1 type three-line hybrid japonica rice sterile line, the specific implementation of the present invention will be further described in detail below in conjunction with the accompanying drawings and examples.
[0025] First of all, in order to ensure more accurate positioning of the molecular characteristics of the Dian-1 three-line hybrid japonica rice sterile line, and to distinguish it from the maintainer line, the restorer line and the hybrid, the patent design and synthesis of the invention uses two pairs of primers to jointly identify the system. The molecules were PCR amplified and directly sequenced. The sequences of csSPF and csSPR1 in the two pairs of primers were AACCAACGCCGACCCCAAAACA and GGCCGCCCTCCCACCTT, respectively; the sequences of the other pair of primers RFSPF2 and RFSPR21 were CCTAATTCATGGTTTGTGCACCTGTA and GCCAAGCAATATCCATTGATAAGAGTATTG, respecti...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
