Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular identification method of Dian-type I three-line hybrid Japonica rice sterile line

A hybrid japonica rice and molecular identification technology, which is applied in the field of molecular identification of the sterile line of a three-line hybrid japonica rice in Yunnan, can solve the problems such as the accuracy rate falling to 80%, the research on sterile genes is lagging behind and declining, and achieving accurate identification, The effect of precise molecular positioning and simple method of fertility gene

Active Publication Date: 2016-03-02
YUNNAN AGRICULTURAL UNIVERSITY
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The selection accuracy rate decreases rapidly with the increase of the recombination rate. In molecular-assisted selection breeding, if the selection accuracy rate is required to reach more than 90%, the recombination rate between the marker and the target gene must be less than 5%. When the recombination rate reaches 10%, , the accuracy of selection has dropped to 80%
[0004] On the other hand, due to the relative lag in the research on sterile genes, as far as the current molecular identification development technology is concerned, there is still a lack of a method and means that can quickly, effectively and accurately detect the sterile line of Dian-1 japonica rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular identification method of Dian-type I three-line hybrid Japonica rice sterile line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0024] In order to further illustrate the molecular identification method of the present invention for the Dian-1 type three-line hybrid japonica rice sterile line, the specific implementation of the present invention will be further described in detail below in conjunction with the accompanying drawings and examples.

[0025] First of all, in order to ensure more accurate positioning of the molecular characteristics of the Dian-1 three-line hybrid japonica rice sterile line, and to distinguish it from the maintainer line, the restorer line and the hybrid, the patent design and synthesis of the invention uses two pairs of primers to jointly identify the system. The molecules were PCR amplified and directly sequenced. The sequences of csSPF and csSPR1 in the two pairs of primers were AACCAACGCCGACCCCAAAACA and GGCCGCCCTCCCACCTT, respectively; the sequences of the other pair of primers RFSPF2 and RFSPR21 were CCTAATTCATGGTTTGTGCACCTGTA and GCCAAGCAATATCCATTGATAAGAGTATTG, respecti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular identification method of a Dian-type I three-line hybrid Japonica rice sterile line. Two pairs of primers (csSPF and csSPR1) and (RFSPF2 and RFSPR21) are designed in dependence on sterile gene in mitochondrial genome in cytoplasm of a Dian-type I Japonica rice sterile line and restoring gene sequences in cell nuclei in the Dian-type I Japonica rice sterile line, respectively, PCR (polymerase chain reaction) amplification is carried out using the two pairs of primers, the Dian-type I Japonica rice sterile line can be accurately judged according to amplification results of the two pairs of primers and distinguished from a maintainer line, a restoring line and a hybrid, and efficient, quick and accurate identification of the sterile line is achieved. Compared with the traditional art, the method has unique design, is simple and is high in accuracy, can fully meet current development requirements, enables more accurate molecular positioning for fertile genes and gives promotion to the development of the gene molecular identification field.

Description

technical field [0001] The patent of the invention belongs to the field of breeding in the field of agricultural biotechnology, and in particular relates to a molecular identification method for a Dian-1 type three-line hybrid japonica rice sterile line. technical background [0002] Rice is one of the most important food crops in my country. The breeding of hybrid rice has made great contributions to the solution of food production and food and clothing problems in my country. The basis for the effective use of rice heterosis is the selection and application of male sterile lines. One of them is cytoplasmic male sterility controlled by the interaction of nuclear genes and cytoplasmic genes, and the other is nuclear male sterility controlled by the interaction of genetics and the environment, including light-sensitive and temperature-sensitive male sterility. At present, there are mainly cytoplasmic male sterile lines in japonica rice that utilize nuclear-cytoplasmic gene in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q2531/113
Inventor 徐津赵锦龙罗碧黄大军谭学林谭亚铃金寿林洪汝科
Owner YUNNAN AGRICULTURAL UNIVERSITY