Graphene accelerated PCR (polymerase chain reaction) technology
A kind of graphene technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment 1
[0046] Specific embodiment one: real-time fluorescent quantitative PCR of human hepatitis B virus
[0047] Viral hepatitis B (referred to as hepatitis B) is a worldwide widespread infectious disease caused by hepatitis B virus. At present, the detection methods of hepatitis B mainly include enzyme immunoassay, radioimmunoassay, chemiluminescence method, and nucleic acid amplification (PCR) fluorescence quantitative method. Detection is important. The present invention selects the common conserved sequence of HBV as the primer sequence to be tested, selects the Hepatitis B virus (HBV) core core region gene (GenBank: X04615.1) as the template gene to be tested, and its sequence is as follows:
[0048] 241acagagtctaga ctcgtggtggacttctctca attttctagggggagcacccacgtgtcc
[0049] 301tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttg
[0050] 361tcctggctatcgctggatgtgtctgcggcgttttatcata ttcctcttcatcctgctgct.
[0051] The preferred HBVc primer sequence is as follows: ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
