Graphene accelerated PCR (polymerase chain reaction) technology

A kind of graphene technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc.

Inactive Publication Date: 2016-03-23
BEIJING LEAGENE BIOTECH CO LTD
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this is much shorter than when the PCR technology was first discovered, due to the increasingly urgent requirements of operators to s

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Graphene accelerated PCR (polymerase chain reaction) technology
  • Graphene accelerated PCR (polymerase chain reaction) technology
  • Graphene accelerated PCR (polymerase chain reaction) technology

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment 1

[0046] Specific embodiment one: real-time fluorescent quantitative PCR of human hepatitis B virus

[0047] Viral hepatitis B (referred to as hepatitis B) is a worldwide widespread infectious disease caused by hepatitis B virus. At present, the detection methods of hepatitis B mainly include enzyme immunoassay, radioimmunoassay, chemiluminescence method, and nucleic acid amplification (PCR) fluorescence quantitative method. Detection is important. The present invention selects the common conserved sequence of HBV as the primer sequence to be tested, selects the Hepatitis B virus (HBV) core core region gene (GenBank: X04615.1) as the template gene to be tested, and its sequence is as follows:

[0048] 241acagagtctaga ctcgtggtggacttctctca attttctagggggagcacccacgtgtcc

[0049] 301tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttg

[0050] 361tcctggctatcgctggatgtgtctgcggcgttttatcata ttcctcttcatcctgctgct.

[0051] The preferred HBVc primer sequence is as follows: ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a graphene accelerated PCR (polymerase chain reaction) technology, in particular an integrated novel modified PCR technology integrating a novel material graphene and PCR and being capable of accelerating nucleic acid amplification, and aims to increase contact between nucleic acid molecules, accelerate PCR process and reduce nonspecific amplification in a PCR system by utilizing the characteristics of adsorption and high-specific surface of graphene. The graphene accelerated PCR technology relates to the field of nucleic acid amplification in molecular biology and molecular tests, is a theoretical innovation integrating the novel material graphene and PCR detection, and can be used for increasing the contact probability of nucleic acid molecules by utilizing the characteristics of adsorption and high-specific surface of graphene, integrating a PCR to slowly release one or various ingredients, combining mineral oil or liquid petrolatum to seal and isolate the external environment, and solving the problem of false positivity caused by over-long reaction time of the PCR and increase of nonspecific amplification due to over-long reaction time of the PCR.

Description

Technical field: [0001] The invention belongs to the field of nucleic acid amplification of molecular biology and molecular testing, and specifically relates to increasing the contact between nucleic acid molecules through graphene adsorption and high specific surface characteristics, accelerating the PCR (polymerase chain reaction) process and reducing non-specific The technical field of heterosexual amplification. Background technique: [0002] Nucleic acid amplification is a highly innovative technology evolved with the development of human genetics, especially the discovery of DNA double strands. In 1983, Kary Mullis of PE-Cetus Company in the United States inadvertently produced the inspiration for nucleic acid amplification: to simulate the natural exponential replication process of DNA in test tubes. The basic principle is to provide suitable reaction systems such as oligonucleotide primers, DNA polymerases, DNA templates, and buffer systems. After DNA denaturation, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/70
CPCC12Q1/6848C12Q2523/308C12Q2531/113
Inventor 刘涛王红郭喜常建元张立明段学明
Owner BEIJING LEAGENE BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap