Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant Bacillus Calmette-Guerin vaccine and construction and application thereof

A technology of recombinant BCG and BCG, applied in the direction of recombinant DNA technology, the use of vectors to introduce foreign genetic material, bacterial antigen components, etc., can solve the problems of inability to protect adult tuberculosis

Active Publication Date: 2016-04-13
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it does not protect against the most common form of tuberculosis in adults
Although the combined effective value of the published literature is 50%, it is estimated that its preventive effect on TB deaths is only 5%, therefore, it is necessary to develop a more effective vaccine to replace the current BCG vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant Bacillus Calmette-Guerin vaccine and construction and application thereof
  • Recombinant Bacillus Calmette-Guerin vaccine and construction and application thereof
  • Recombinant Bacillus Calmette-Guerin vaccine and construction and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 PtpA inhibits JNK and p38 signaling pathways

[0033] The Mycobacterium tuberculosis secretory protein PtpA, which can inhibit JNK and p38 signaling pathways, has an amino acid sequence shown in SEQ ID NO:1.

[0034] (A) Dual luciferase reporter system and WesternBlot experiment:

[0035] (1) Subculture 293T cells in good growth state into 24-well plates before testing, and culture overnight;

[0036] (2) Simultaneous transfection of pFA2-cJun, Gal4-Luc luciferase reporter gene plasmid, pRL-TK (Yisheng Biology) and RacL61 plasmid (insert the RacL61 gene into the p3xFlagCMV vector) in each well, transfection or no transfection at the same time Transfect the plasmid p3xFlagCMV14 containing the gene encoding PtpA as a control, and continue to cultivate for 6-8 hours;

[0037] Preparation of transfection solution: Take two EP tubes and prepare the following two solutions (the amount used for transfecting cells per 10 cm culture dish, the amount used for 24-well ...

Embodiment 2

[0048] Example 2 Recombinant BCG bacterial strain promotes cytokine secretion

[0049] (A) PtpA gene knockout method:

[0050] (1) The pJV53 plasmid (Addgene) was electrotransferred into BCG competent cells, and positive clones were screened on the Middlebrook7H10Agar (BD) plate containing kanamycin;

[0051] (2) Pick positive clones, inoculate them in Middlebrook 7H9 (BD) medium containing kanamycin resistance, and culture them at 37 degrees Celsius for 20 days, centrifuge to harvest BCG carrying pJV53k and prepare competent for use;

[0052] (3) Synthesis of ptpA gene upstream (AB) gene fragment

[0053] (AAGCTTCCCGCCCATGCATGAGACGCTGCGCGCCATGGGGCTCGGCGAATCCGCCGAGGAGGCGATCGTAGCCTACCGGGCCGACTACAGCGCCCGCGGTTGGGCGATGAACAGCTTGTTCGACGGGATCGGGCCGCTGCTGGCCGACCTGCGCACCGCCGGTGTCCGGCTGGCCGTCGCCACCTCCAAGGCAGAGCCGACCGCACGGCGAATCCTGCGCCACTTCGGAATTGAGCAGCACTTCGAGGTCATCGCGGGCGCGAGCACCGATGGCTCGCGAGGCAGCAAGGTCGACGTGCTGGCCCACGCGCTCGCGCAGCTGCGGCCGCTACCCGAGCGGTTGGTGATGGTCGGCGACCGCAGCCACGACGTCGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant Bacillus Calmette-Guerin vaccine and construction and application thereof and belongs to the technical field of microbiological biotechnology. A recombinant BCG (Bacillus Calmette-Guerin) strain obtained by knocking out Bacillus Calmette-Guerin secretory protein PtpA is determined for the first time to be able to facilitate secretion of macrophages and mouse cell factors. The achievement of the invention can provide an idea to construct a novel more efficient BCG recombinant vaccine, and the idea has a promising prospect particularly in terms of BCG vaccine development and clinical application.

Description

technical field [0001] The invention relates to a recombinant BCG and its construction and application, belonging to the field of microbial biotechnology. Background technique [0002] Tuberculosis (Tuberculosis, TB) is an ancient disease caused by Mycobacterium tuberculosis (Mycobacterium tuberculosis). It, together with AIDS and malaria, is known as the three major infectious diseases that threaten human health in the world today. Studies have shown that the Mycobacterium tuberculosis genome encodes 11 serine / threonine protein kinases (Serine / threonine protein kinase, STPK) and two eukaryotic-like tyrosine phosphatases (PtpA and PtpB). The process of macrophages can be secreted into the cytoplasm of host cells, these proteins interact with different protein molecules in host cells, and interfere with eukaryotes by regulating the phosphorylation level of each target protein in host cells The purpose of signaling pathways. These pathogen-host interaction proteins and their...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/04C12N15/74A61P31/06
Inventor 刘翠华汪静李冰曦葛浦浦
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com