Production technology of bovine trypsin

A bovine trypsin and production technology technology, applied in the directions of enzymes, peptidases, hydrolase, etc., can solve the problems of low yield and poor effect, achieve high expression, renaturation and subsequent purification steps are simple and easy to implement, The effect of low process cost

Active Publication Date: 2016-04-13
LETO LAB CO LTD
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, only the method of preparing porcine and human trypsin by renaturation of inclusion bodies has been reported, and there is no method of preparing bovine trypsin by renaturation of inclusion bodies
Moreover, in practical applications, human-derived and porcine-derived trypsin are not as good as bovine-derived trypsin when trypsin is used to digest certain substrate proteins. When cutting some recombinant fusion proteins, the effect is not good and the yield is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Production technology of bovine trypsin
  • Production technology of bovine trypsin
  • Production technology of bovine trypsin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The production technology of embodiment 1 bovine trypsin

[0033] 1. Construction of prokaryotic production strains

[0034]The amino acid sequence of bTrypsin (bovine trypsinogen) is shown in SEQ ID NO:1. The nucleic acid sequence of bovine trypsinogen is deduced according to its amino acid sequence, and the codon is optimized to make it suitable for expression in genetically engineered bacteria. The nucleic acid sequence is shown in SEQ ID NO:2.

[0035] Using the method of whole gene synthesis, the gene is synthesized. bTrypsin was cloned into the commercial expression vector pET21b by means of restriction endonucleases NdeI and BamHl. The experimental procedure is as follows:

[0036] PCR technology was used to amplify the target fragment from the cloning vector.

[0037] The primer sequences are as follows (5'-3'):

[0038] bTrypsin21b-F:GGGAATTCCATATGATCGTTGGTGGTTACACCTG

[0039] bTrypsin21b-R:CGCGGATCCTTAGTTAGAAGCGATGGTCTGT

[0040] The PCR reaction syste...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a production technology of bovine trypsin. By means of a gene recombination technology, bovine trypsinogen or inclusion body protein of bovine trypsinogen fusion protein are expressed out in escherichia coli, and then acidizing is carried out to denature and renature the inclusion body protein into folded bovine trypsinogen or bovine trypsinogen fusion protein. By the adoption of a prokaryotic expression system, the expression quantity is high, denaturation, renaturation and follow-up steps are simple and easy to implement, and the technological cost is low. The prepared bovine trypsin with activity can be used for production of recombinant human insulin and insulin analogues.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and protein purification, in particular to a production process of bovine trypsin. Background technique [0002] Trypsin (trypsin EC3.4.21.4) is an endopeptidase secreted by the pancreas, which secretes inactive trypsinogen, which is then activated into active trypsin by enterokinase or trypsin in the small intestine , and then active trypsin can activate more trypsinogen. Bovine trypsin contains 223 amino acid residues and has a molecular weight of 23.3KDa. [0003] Trypsin can selectively hydrolyze the C-terminus of all lysine Lys or arginine Arg in proteins, which can not only act as a digestive enzyme, but also limit the decomposition of chymotrypsinogen, carboxypeptidase and other enzymes precursor to activate the zymogen. Trypsin is the most specific protease and plays a vital role in identifying and analyzing the arrangement of protein amino acid sequences. Clinically, trypsi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/76
CPCC12N9/6427C12Y304/21004
Inventor张维李树宝杜敬
OwnerLETO LAB CO LTD