zc3hav1 gene and its application
A gene, H5N1 technology, applied to the ZC3HAV1 gene and its application field, can solve the problems of breaking the balance between waterfowl and influenza virus, and achieve the effect of inhibiting replication
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] A new anti-AIV infection gene ZC3HAV1 was discovered by analyzing the transcriptome data.
[0033] Waterfowl, including domestic ducks, are the natural hosts of H5N1 subtype influenza virus, and some H5N1 subtype viruses do not show obvious clinical symptoms after infection. As the virus continues to evolve, strains with high pathogenicity to waterfowl also appear. In this study, two strains of H5N1 subtypes (highly pathogenic A / duck / Hubei / 49 / 05 (DK / 49) and low pathogenic A / goose / Hubei / 65 / 05 (GS / 65) were selected. ) H5N1 virus), infecting 4-week-old Shaoxing ducklings. Through the method of high-throughput sequencing, the gene expression profiles of spleen, brain and lung tissues of ducks infected with DK / 49 or GS / 65H5N1 influenza virus 1 day, 2 days and 3 days, and control ducks were respectively constructed, and the genes involved in the body's anti-inflammatory activity were identified. The immune gene related to influenza virus provides a new method for the treatm...
Embodiment 2
[0036] The sequence of the full-length coding region of the duck ZC3HAV1 gene was obtained by means of molecular biology experiments.
[0037] Referring to the duck genome reference sequence on the Ensemble website, and according to the transcriptome splicing sequence, design the duck ZC3HAV1 gene full-length CDS region cloning primer ZF / ZR, the sequence is as follows:
[0038] ZF: 5'-ATGAGCGACC CGGTGGTGTG CAGCT-3',
[0039] ZR: 5'-GGGCTACAAA CAGCTCTGAT CACTT-3'.
[0040] Using the cDNA of duck spleen tissue as a template, NEB company's Q5 high-fidelity polymerase was used for PCR amplification, and the amplified product was recovered by gel and ligated to T carrier for sequencing. After sequence comparison analysis, it was found that the full-length coding region of the duck ZC3HAV1 gene is 2154bp (SEQ ID NO.1), encoding a total of 717 amino acids (SEQ ID NO.2).
[0041] The inventors successfully cloned the full-length coding region sequence of the duck ZC3HAV1 gene.
Embodiment 3
[0043] Transient overexpression of ZC3HAV1 gene in cells by cytology experiment method
[0044] 1. Construction of duck ZC3HAV1 gene overexpression vector
[0045] According to the coding region sequence of duck ZC3HAV1 gene, its eukaryotic expression vector primer eZF / eZR was designed, and the upstream and downstream primers were respectively introduced into Mlu I and Pme I restriction sites (underlined); A kozak (marked in bold) sequence was introduced before ATG, and a flag tag (marked in bold) was introduced at the C-terminus of the target gene. The primer sequences are as follows:
[0046] eZF:
[0047] 5'-G ACGCGT GCCACCATGAGCGACCCGGTGGTGTGCAGCT-3';
[0048] eZR:
[0049] 5'-GG GTTTAAAC TTACTTATCGTCGTCATCCTTGTAATCAGATATAATACATTTTTTTCCTGCCTCC-3'.
[0050] The CDS sequence of the amplified ZC3HAV1 gene (as shown in the sequence table CDS) was introduced into the original vector PiggyBac-X gene (constructed by the inventor's laboratory in the early stage, and the vec...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



