Unlock instant, AI-driven research and patent intelligence for your innovation.

zc3hav1 gene and its application

A gene, H5N1 technology, applied to the ZC3HAV1 gene and its application field, can solve the problems of breaking the balance between waterfowl and influenza virus, and achieve the effect of inhibiting replication

Inactive Publication Date: 2019-08-20
CHINA AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, with the continuous evolution of influenza viruses, the balance between waterfowl and influenza viruses is broken

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • zc3hav1 gene and its application
  • zc3hav1 gene and its application
  • zc3hav1 gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] A new anti-AIV infection gene ZC3HAV1 was discovered by analyzing the transcriptome data.

[0033] Waterfowl, including domestic ducks, are the natural hosts of H5N1 subtype influenza virus, and some H5N1 subtype viruses do not show obvious clinical symptoms after infection. As the virus continues to evolve, strains with high pathogenicity to waterfowl also appear. In this study, two strains of H5N1 subtypes (highly pathogenic A / duck / Hubei / 49 / 05 (DK / 49) and low pathogenic A / goose / Hubei / 65 / 05 (GS / 65) were selected. ) H5N1 virus), infecting 4-week-old Shaoxing ducklings. Through the method of high-throughput sequencing, the gene expression profiles of spleen, brain and lung tissues of ducks infected with DK / 49 or GS / 65H5N1 influenza virus 1 day, 2 days and 3 days, and control ducks were respectively constructed, and the genes involved in the body's anti-inflammatory activity were identified. The immune gene related to influenza virus provides a new method for the treatm...

Embodiment 2

[0036] The sequence of the full-length coding region of the duck ZC3HAV1 gene was obtained by means of molecular biology experiments.

[0037] Referring to the duck genome reference sequence on the Ensemble website, and according to the transcriptome splicing sequence, design the duck ZC3HAV1 gene full-length CDS region cloning primer ZF / ZR, the sequence is as follows:

[0038] ZF: 5'-ATGAGCGACC CGGTGGTGTG CAGCT-3',

[0039] ZR: 5'-GGGCTACAAA CAGCTCTGAT CACTT-3'.

[0040] Using the cDNA of duck spleen tissue as a template, NEB company's Q5 high-fidelity polymerase was used for PCR amplification, and the amplified product was recovered by gel and ligated to T carrier for sequencing. After sequence comparison analysis, it was found that the full-length coding region of the duck ZC3HAV1 gene is 2154bp (SEQ ID NO.1), encoding a total of 717 amino acids (SEQ ID NO.2).

[0041] The inventors successfully cloned the full-length coding region sequence of the duck ZC3HAV1 gene.

Embodiment 3

[0043] Transient overexpression of ZC3HAV1 gene in cells by cytology experiment method

[0044] 1. Construction of duck ZC3HAV1 gene overexpression vector

[0045] According to the coding region sequence of duck ZC3HAV1 gene, its eukaryotic expression vector primer eZF / eZR was designed, and the upstream and downstream primers were respectively introduced into Mlu I and Pme I restriction sites (underlined); A kozak (marked in bold) sequence was introduced before ATG, and a flag tag (marked in bold) was introduced at the C-terminus of the target gene. The primer sequences are as follows:

[0046] eZF:

[0047] 5'-G ACGCGT GCCACCATGAGCGACCCGGTGGTGTGCAGCT-3';

[0048] eZR:

[0049] 5'-GG GTTTAAAC TTACTTATCGTCGTCATCCTTGTAATCAGATATAATACATTTTTTTCCTGCCTCC-3'.

[0050] The CDS sequence of the amplified ZC3HAV1 gene (as shown in the sequence table CDS) was introduced into the original vector PiggyBac-X gene (constructed by the inventor's laboratory in the early stage, and the vec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a duck ZC3HAV1 gene and an amino acid sequence encoded by the ZC3HAV1 gene, the ZC3HAV1 gene can be used for inhibiting influenza virus, and in particular, can significantly inhibit the replication of AIV (avian influenza virus), and by in-depth research on the function of the gene ZC3HAV1, an anti-AIV key protein structure domain or amino acid can be determined. Transgenic technology and other gene editing methods are used, ZC3HAV1-gene-transgenic livestock and poultry are used, and good transgenic agriculture animal varieties resisting AIV and other a variety of types of viruses can be bred.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology and genetic engineering, and in particular relates to a ZC3HAV1 gene and its application. Background technique [0002] Influenza viruses are negative-strand RNA viruses containing eight RNA genome segments. Highly pathogenic avian influenza (Highly Pathogenic Avian Influenza, HPAI) is a severe infectious disease mainly in poultry caused by influenza A virus of the Orthomyxoviridae family. [0003] Waterfowl, including domestic ducks, are the natural hosts of influenza virus, and all subtypes of different combinations of 16 HA and 9 NA could be isolated in waterfowl. Influenza virus has always maintained the characteristics of low pathogenicity to waterfowl. Waterfowl infected with the virus will not get sick, but they can shed the virus to the outside world. Certain strains with low pathogenicity to waterfowl are highly pathogenic to chickens or other hosts. However, with the contin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C07K14/46C12N15/85C12N5/10A01K67/027
Inventor 黄银花李宁荣恩光王小雪
Owner CHINA AGRI UNIV