CRISPR-Cas9 specificity pig SLA-1 gene knockout method and sgRNA used for specific targeting SLA-1 gene

A SLA-1, specific technology, applied in the field of genetic engineering and gene knockout, can solve the problems of low recombination efficiency, tedious and time-consuming work, high off-target rate, etc., and achieve the effect of high cost and long solution cycle

Inactive Publication Date: 2016-05-18
THE SECOND PEOPLES HOSPITAL OF SHENZHEN
View PDF2 Cites 43 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

HR technology is inefficient due to reorganization (efficiency is only about 10 -6 ), the screening of mutants is very time-consuming and inefficient, and has gradually been replaced by
The cutting efficiency of TALEN technology and ZFN technology can generally reach 20%, but both require the construction of protein modules that can recognize specific sequences, and the preliminary work is tedious and time-consuming
The module design of ZFN technology is relatively complex and has a high miss rate, and its application is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR-Cas9 specificity pig SLA-1 gene knockout method and sgRNA used for specific targeting SLA-1 gene
  • CRISPR-Cas9 specificity pig SLA-1 gene knockout method and sgRNA used for specific targeting SLA-1 gene
  • CRISPR-Cas9 specificity pig SLA-1 gene knockout method and sgRNA used for specific targeting SLA-1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1, Selection and design of Susscrofa (pig) SLA-1 gene sgRNA target sequence

[0066] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0067] 1. SgRNA target sequence selection of SLA-1 gene

[0068] For the SLA-1 gene, the following principles should be followed in the selection of target sequences:

[0069] (1) Find the target sequence conforming to the 5'-N(20)NGG-3' rule in the exon coding region of the SLA-1 gene, where N(20) represents 20 consecutive bases, and each N represents A Or T or C or G, the target sequence conforming to the rules can be located on the sense strand or the antisense strand;

[0070] (2) Select the 4 exon coding region sequences near the N-terminus, the cleavage of such coding region sequences will cause the func...

Embodiment 2

[0090] Embodiment 2, constructing the sgRNA expression vector of SLA-1 gene

[0091] 1. Synthesis of DNA Inserts

[0092] (1) Synthesize the forward and reverse oligonucleotide sequences designed above

[0093] The oligonucleotide sequence can be specifically synthesized by a commercial company (such as Invitrogen) according to the provided sequence. In this example and the following examples, the effect of the target sequences listed in the No. 1 and No. 2 sequences listed in Table 1 on the knockout effect of the SLA-1 gene was studied.

[0094] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 1 target sequence are as follows:

[0095] CACCGTCAGGGAGTGGGGACCCGCC (SEQ ID NO: 164);

[0096] AAACGGCGGGTCCCCACTCCCTGAC (SEQ ID NO: 165).

[0097] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 2 target sequence are as follows:

[0098] CACCGCAGGGAGTGGGGACCCGCCT (SEQ ID NO: 166);

[009...

Embodiment 3

[0135] Example 3. Obtaining a pseudotyped lentivirus expressing SLA-1 sgRNA

[0136] 1. Material preparation

[0137] Amplify and extract packaging plasmids pLP1, pLP2, and pLP / VSVG (purchased from Invitrogen, whose maps are shown in figure 2 , image 3 with Figure 4 shown); amplify and extract vector plasmid lentiCRISPRv2-SLA-1; culture packaging cell line HEK293T cells (purchased from ATCC); DMEM medium, Opti-MEM medium and fetal bovine serum FBS (purchased from Gibco); Lipofectamine2000 (purchased from Invitrogen); HEK293T cells were cultured in 5% CO 2 In the culture environment of 37°C, the culture medium is DMEM medium containing 10% FBS.

[0138] 2. Transfection and Viral Packaging

[0139] Day 1: Passage the packaging cell line HEK293T to 10cmdish, about 30% confluence;

[0140] The next day: when HEK293T reaches 80% confluence, transfect according to the following recipe:

[0141] Prepare Mixture 1, containing:

[0142] lentiCRISPRv2-SLA-1: 6 μg

[0143] pL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Upstream primeraaaaaaaaaa
Login to View More

Abstract

The present invention discloses a pig SLA-1 gene knockout method using CRISPR-Cas9 specificity and sgRNA used for specific targeting SLA-1 gene. The target sequence of the sgRNA used for specific targeting SLA-1 gene in the SLA-1 gene complies with a 5'-N (20) NGG-3' sequence arrangement rule, wherein N (20) represents 20 consecutive basic groups, wherein each N represents a A or T or C or G; the target sequence in the SLA-1 gene is located at the four exon coding regions of the N-terminal of the SLA-1 gene or the junction of adjacent introns; and the target sequence in the SLA-1 gene is unique. The sgRNA used in the pig SLA-1 gene knockout method using CRISPR-Cas9 specificity, may fast, accurately, efficiently, and specifically knockout pig SLA-1 gene, effectively solve long cycle and high cost in construction of SLA-1 gene knockout pig.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the technical field of gene knockout, in particular to a method for specifically knocking out the pig SLA-1 gene by CRISPR-Cas9 and an sgRNA for specifically targeting the SLA-1 gene. Background technique [0002] Organ transplantation is the most effective treatment for diseases of organ failure. So far, nearly one million patients around the world have extended their lives through organ transplantation. With the aging of the population and the advancement of medical technology, more and more patients need organ transplantation, but the shortage of donor organs seriously restricts the development of organ transplantation. Taking kidney transplantation as an example, as many as 300,000 patients need kidney transplantation in my country every year, but no more than 10,000 donated kidneys can be used for transplantation, and most patients die of kidney failure. Relyin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867
CPCC12N15/1138C12N15/86C12N2310/11C12N2740/15045C12N2810/10C12N15/113
Inventor蔡志明牟丽莎陈鹏飞谢崇伟张军方高汉超陆赢刘璐
OwnerTHE SECOND PEOPLES HOSPITAL OF SHENZHEN