Typing detection kit for FK506 personalized medication related genes
A detection kit, the technology of tacrolimus, is used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. Problems such as simultaneous detection of multiple sites
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1: Detection of standard plasmids of different genotypes by a single site probe
[0042] Experimental procedure: (1) Preparation of wild-type standard plasmid containing the target SNP site: according to the NCBI SNP database (http: / / www.ncbi.nlm.nih.gov / projects / SNP / ), obtain rs55951658, rs28371759, and Sequence information of the three sites of rs776746 (including 500bp upstream and downstream of the SNP site), design three pairs of amplification primers:
[0043] rs55951658F:CCTGTCCCCACCAGATTCAT,
[0044] rs55951658R:CTTGTCTGTCTCCACTCCGT;
[0045] rs28371759F:GCCCACATTCTCGAAGACCT,
[0046] rs28371759R:CAGAGCCAGCACGTTTTACA;
[0047] rs776746F:TCTCCCCTCAAGTCCTCAGA,
[0048] rs776746R: TTCACTAGCCCGATTCTGCA.
[0049] Use primers to amplify the DNA fragments, and the fragment sizes of the obtained wild-type standard items are:
[0050] rs55951658: 543bp,
[0051] rs28371759: 598bp,
[0052] rs776746: 553bp, respectively inserted into the pGEM-T vector, tha...
Embodiment 2
[0064] Example 2: Triple fluorescent PCR amplification typing of three loci
[0065] Firstly, I tried the triple system detection pre-experiment, and used the constructed standard plasmids of various genotypes as templates. The experimental results showed that the detection of the three sites in the triple detection system can be realized without mutual interference, and can Correctly distinguish wild homozygotes, heterozygotes and mutant homozygotes for the three loci.
[0066] Result reading: The result of rs55951658 site is presented in the FAM channel, the peak of the wild type is at 65°C, and the peak of the mutant type is at 62°C, both positions have peaks indicating heterozygosity; the result of rs28371759 site is presented in the ROX channel, the wild type The peak of the mutant is at 66°C, the peak of the mutant is at 63°C, and there are peaks at both positions indicating that it is a heterozygote; the result of the rs776746 site is displayed on the HEX channel, the p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
