Unlock instant, AI-driven research and patent intelligence for your innovation.

Typing detection kit for FK506 personalized medication related genes

A detection kit, the technology of tacrolimus, is used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. Problems such as simultaneous detection of multiple sites

Inactive Publication Date: 2016-11-09
上海泽因生物科技有限公司
View PDF4 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the advantage of strong specificity of recognition is that when detecting a SNP, two probes of two different genotypes are required for one site, which makes it difficult to simultaneously detect multiple sites (more than 2 sites). In addition, the increased experimental cost
[0005] Most of the real-time PCR methods currently used are single fluorescent PCR methods, which can only detect one SNP site at a time, and the detection speed and sensitivity are difficult to meet the requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Typing detection kit for FK506 personalized medication related genes
  • Typing detection kit for FK506 personalized medication related genes
  • Typing detection kit for FK506 personalized medication related genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Detection of standard plasmids of different genotypes by a single site probe

[0042] Experimental procedure: (1) Preparation of wild-type standard plasmid containing the target SNP site: according to the NCBI SNP database (http: / / www.ncbi.nlm.nih.gov / projects / SNP / ), obtain rs55951658, rs28371759, and Sequence information of the three sites of rs776746 (including 500bp upstream and downstream of the SNP site), design three pairs of amplification primers:

[0043] rs55951658F:CCTGTCCCCACCAGATTCAT,

[0044] rs55951658R:CTTGTCTGTCTCCACTCCGT;

[0045] rs28371759F:GCCCACATTCTCGAAGACCT,

[0046] rs28371759R:CAGAGCCAGCACGTTTTACA;

[0047] rs776746F:TCTCCCCTCAAGTCCTCAGA,

[0048] rs776746R: TTCACTAGCCCGATTCTGCA.

[0049] Use primers to amplify the DNA fragments, and the fragment sizes of the obtained wild-type standard items are:

[0050] rs55951658: 543bp,

[0051] rs28371759: 598bp,

[0052] rs776746: 553bp, respectively inserted into the pGEM-T vector, tha...

Embodiment 2

[0064] Example 2: Triple fluorescent PCR amplification typing of three loci

[0065] Firstly, I tried the triple system detection pre-experiment, and used the constructed standard plasmids of various genotypes as templates. The experimental results showed that the detection of the three sites in the triple detection system can be realized without mutual interference, and can Correctly distinguish wild homozygotes, heterozygotes and mutant homozygotes for the three loci.

[0066] Result reading: The result of rs55951658 site is presented in the FAM channel, the peak of the wild type is at 65°C, and the peak of the mutant type is at 62°C, both positions have peaks indicating heterozygosity; the result of rs28371759 site is presented in the ROX channel, the wild type The peak of the mutant is at 66°C, the peak of the mutant is at 63°C, and there are peaks at both positions indicating that it is a heterozygote; the result of the rs776746 site is displayed on the HEX channel, the p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a typing detection kit of a multi-PCR fluorescence labelled probe for FK506 personalized medication related genes. According to three specific SNP sites, with high pertinence to metabolism of FK506, on CYP3A4 and CYP3A5 encoding genes, three pairs of amplification primers and three fluorescent probes are designed, a PCR instrument is adopted to amplify to-be-detected three segments of DNA sequences, hybridization of the fluorescent probes and amplified products is utilized to detect hybridization peaks in a reaction system, and Tm values displayed on the standard hybridization peaks for gene typing are determined as the result judgment standards by construction and detection based on wild-type and mutant standard plasmids. The typing detection kit is high in method flexibility, strong in specificity, simple and convenient to operate, and straightforward and clear in result observation, and two genetypes have significant differences and are easy to type. The typing detection kit is suitable for one-tube triple quick detection of three SNP sites of FK506 metabolism related genes.

Description

technical field [0001] The invention relates to a method for genotyping and detecting genes related to tacrolimus personalized medication by multiple PCR-fluorescent probes. Specifically, it is an application of a multiplex fluorescent PCR technology that achieves target genotyping through standard comparison to the detection and typing of tacrolimus personalized drug-related genes. Background technique [0002] Tacrolimus (FK506) is an immunosuppressant widely used in the prevention of organ transplant rejection. At present, the "standard" drug administration method is used clinically, and the conventional dosage is 0.1-0.12mg / kg, but the therapeutic index of FK506 is narrow, and the pharmacokinetics of different individuals vary greatly, which makes the standard dosage administration method unreachable. In addition, FK506 is an immunosuppressant that patients after kidney transplantation need to take for life, and the price is relatively expensive. Therefore, it is necess...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q1/686C12Q2600/106C12Q2600/156C12Q2600/16C12Q2537/143C12Q2563/107
Inventor 熊乾斌
Owner 上海泽因生物科技有限公司