Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-herbicide and anti-pest fusion gene, encoded protein thereof, and application of encoding protein

A herbicide-resistant, fusion gene technology, used in applications, fusion peptides, genetic engineering, etc.

Inactive Publication Date: 2017-02-15
ZHEJIANG UNIV
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still some problems in the actual operation and application of the above method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-herbicide and anti-pest fusion gene, encoded protein thereof, and application of encoding protein
  • Anti-herbicide and anti-pest fusion gene, encoded protein thereof, and application of encoding protein
  • Anti-herbicide and anti-pest fusion gene, encoded protein thereof, and application of encoding protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1 Construction of herbicide-resistant insect-resistant fusion protein expression vector

[0027] The fusion gene formed by the fusion of the glufosinate-ammonium-resistant gene bar and the insect-resistant gene Vip3A is named bar-Vip3A gene, and the encoded protein polypeptide sequence is shown in SEQ ID NO:3. The fusion gene formed by the fusion of the glyphosate-resistant gene Gat and the insect-resistant gene Cry1Ab is named Gat-Cry1Ab gene, and the encoded protein polypeptide sequence is shown in SEQ ID NO:4.

[0028] The bar-Vip3A (SEQ ID NO: 1) gene and the Gat-Cry1Ab (SEQ ID NO: 2) gene are both artificially synthesized, and both have a BamHI restriction site at the 5' end, and both are added at the 3' end A synthetic terminator and a KpnI restriction site were set.

[0029] pUBI is a maize ubiquitin promoter obtained by PCR. PCR primers pUBI-F (5'GAAGCTTGCATGCCTACAGTGCAGCGTGACCC) and pUBI-R (5'GGGTGGATCCTCTAGAGTCGACCTGCAGAAGTAAC) were designed, and ...

Embodiment 2

[0035] Embodiment 2, transformation of rice

[0036] The method of obtaining transgenic rice is to adopt the existing technology (Lu Xiongbin, Gong Zuxun (1998) Life Science 10: 125-131; Liu Fan et al. (2003) Molecular Plant Breeding 1: 108-115). The mature and plump seeds of "Xiushui-134" were dehulled, and callus was induced as transformation materials. The Agrobacterium plates of the vectors pCambia1300-pUBI-bar-Vip3A-p35S-1174 and pCambia1300-pUBI-Gat-Cry1Ab-p35S-1174 constructed in Example 1 were respectively taken. Pick a single colony to inoculate and prepare Agrobacterium for transformation. Put the callus to be transformed into the Agrobacterium bacterium solution with an OD of about 0.6 (preparation of the Agrobacterium bacterium solution: inoculate the Agrobacterium into the medium, and cultivate it at 28°C until the OD is about 0.6; the composition of the medium: 3g / L K 2 HPO 4 , 1g / LNaH 2 PO 4 , 1g / LNH 4 Cl, 0.3g / L MgSO 4 ·7H 2 O, 0.15g / L KCl, 0.01g / L Ca...

Embodiment 3

[0037] Embodiment 3, fusion protein transgenic rice can resist herbicides

[0038] The T0 generation plants of the transgenic rice plants prepared by the method in Example 2 were transplanted into the greenhouse, and the herbicide resistance of the transgenic rice plants and the non-transgenic recipient control plant "Xiu Shui-134" were compared and analyzed. We obtained 86 transgenic lines (named BV) transfected with pCambia1300-pUBI-bar-Vip3A–p35S-1174 vectors for different concentrations of glufosinate-ammonium resistance tests, and the resistance effects are shown in Table 1:

[0039] Table 1*:

[0040] 1x 2x 3x Number of resistant transformation events 65 52 30

[0041]*Note: Table 1 shows the resistance test of rice plants sprayed with different concentrations of glufosinate-ammonium 15 days after sowing. 10 days after spraying glufosinate-ammonium, the plants with no significant difference in plant height, number of leaves and growth vigor com...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an anti-herbicide and anti-pest fusion gene, an encoded protein thereof, and an application of the encoded protein. The fusion gene is formed by an anti-herbicide protein encoding gene and an anti-pest fusion protein encoding gene. The anti-herbicide and anti-pest fusion protein simultaneously has anti-herbicide and anti-pest characteristics; and the quantity of anti-herbicide protein molecules in plants is same to the quantity of anti-pest protein molecules in the plants in the production process of transgenic crops, so the encoded protein can be applied to anti-herbicide and anti-pest fields of monocotyledons and dicotyledon, and is mainly applied to anti-herbicide and anti-pest corn, rice, soybean, wheat and rape.

Description

[0001] (1) Technical field [0002] The invention relates to a herbicide-resistant insect-resistant fusion gene, encoded protein and application. [0003] (2) Background technology [0004] Weeds and pests are the most important biological factors affecting yield in agricultural production. How to reduce the control cost of weeds and pests, improve the control efficiency, and reduce the environmental pollution during the control process are the most critical issues in agricultural science research. [0005] Weeds are produced along with human production activities, and their existence is the result of long-term adaptation to climate, soil, crops, farming systems and social factors and competition with cultivated crops. Human beings have been controlling weeds since the beginning of agricultural production, but weed control at that time was only an extremely extensive primary labor. With the development of science, especially the development and progress of modern life science...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C07K19/00C12N15/82A01H5/00
CPCC07K14/325C07K14/36C07K2319/00C12N9/1029C12N15/8274C12N15/8275C12N15/8277C12N15/8286
Inventor 王东芳张先文沈志成
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com