Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for degrading triadimenol in soil by virtue of novel microbial strain

A technology of triadimenol and bacterial strains, which is applied in the field of microbial applications, can solve problems such as triadimenol residues, and achieve the effect of wide application prospects

Inactive Publication Date: 2017-02-22
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a new microbial strain with higher efficiency for degrading triadimenol in view of the current problem of triadimenol residues; secondly, to provide a set of methods for rapidly and efficiently degrading triadimenol in polluted soil by using the strain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for degrading triadimenol in soil by virtue of novel microbial strain
  • Method for degrading triadimenol in soil by virtue of novel microbial strain
  • Method for degrading triadimenol in soil by virtue of novel microbial strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1: the screening of new bacterial strain E-9

[0037] The present invention collects the activated sludge of the aeration tank from a pesticide factory in Zhejiang Province, and rapidly screens bacterial species from it within 24 hours; the specific method of screening is: take 10g of activated sludge, place it in 100mL enrichment medium, and simultaneously Add 0.1mL of 100g / L triadimenol original drug to make the final concentration 100mg / L, and at 30℃, 180r.min -1 Culture on a shaking table, inoculate once every 7 days thereafter, inoculate into fresh medium with 10% inoculum, and gradually increase the concentration of the tested pesticide to 600 mg / L with 100 mg / L as an increase unit. Then the culture solution was added to the inorganic salt medium with the tested pesticide triadimenol (600mg / L) as the only carbon source for acclimatization 2-5 times, 7 days each time, and finally separated on the ordinary medium by smearing. Select colonies with fast grow...

Embodiment 2

[0041] Embodiment 2: Identification of new bacterial strain E-9

[0042] For the strain E-9 screened in Example 1, the strain collection center of Wuhan University was entrusted with the measurement and analysis of the 16SrRNA gene sequence of the microbial strain, the observation of the morphology of the strain, and the identification of the physiological and biochemical characteristics of the microbial strain. According to the above test results, strain E-9 was identified as Achromobacterxylosoxidans, Gram-negative, and this strain was preserved in Wuhan China Type Culture Collection Center on June 24, 2016. The number is CCTCCNO:M2016348.

[0043] Strain E-9CCTCC NO:M 2016348 16S rRNA gene sequence:

[0044] GGCACGATCTACGTGGTATCGCCCCCCTTGCGGTTAGGCTAACTACTTCTGGTAAAACCCACTCCCATGGTGTGACGGGCGGTGTGTACAAGACCCGGGAACGTATTCACCGCGACATGCTGATCCGCGATTACTAGCGATTCCGACTTCACGCAGTCGAGTTGCAGACTGCGATCCGGACTACGATCGGGTTTCTGGGATTGGCTCCCCCTCGCGGGTTGGCGACCCTCTGTCCCGACCATTGTATGACGTGTGAAGCCCTACCCATA...

Embodiment 3

[0052] Embodiment 3: Utilize strain E-9 to degrade the method 1 of triadimenol in soil

[0053] Follow these steps:

[0054] (1) Strain activation medium: yeast powder 5.0g, peptone 10.0g, NaCl 5.0g, distilled water 1000mL, pH7.0. After being sterilized, it is ready for use;

[0055] (2) Strain fermentation medium: (NH 4 ) 2 SO 4 1.0g, FeSO 4 ·7H 2 O 0.005g, CaSO 4 0.08g, Na 2 MoO 4 2H 2 O 0.0033g, MgSO 4 0.2g, K 2 HPO 4 1.0g, KH 2 PO 4 1.0g, 3.0g sucrose, 0.5g peptone, 1000mL distilled water, pH 7.0. After being sterilized, it is ready for use;

[0056] (3) Preparation of seed liquid: Pick the preserved strain E-9CCTCC NO:M 2016348 of 1-ring Achromobacterxylosoxidans slant, insert it into the medium of step (1), and put it under the conditions of 30°C and 180rpm After 24 hours of shaking culture, the seed liquid was obtained and set aside;

[0057] (4) Preparation of the degrading bacterial agent: insert the seed solution of step (3) into the medium of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for degrading triadimenol in soil by virtue of a novel microbial strain, and belongs to the technical field of application of microorganisms. The novel achromo bacterxylosoxidans strain E-9, CCTCC NO: M2016348, which is capable of degrading the triadimenol, is screened from soil; and subsequently, a method for degrading the triadimenol in the soil by virtue of the strain comprises such steps of preparation of a culture medium, activating cultivation of the strain, preparation of a degrading inoculant, application of the degrading inoculant in contaminated soil, determination of a triadimenol residue amount, and the like. Under optimized technical conditions, the method can reach a degrading rate on the triadimenol in the soil to 56% or above at the 30th day and can a degrading rate on the triadimenol in the soil to 66% or above at the 45th day; therefore, the method has the characteristics of being rapid, efficient, simple, practical and the like. The method can be popularized and applied to degrading treatment of triadimenol-contaminated soil areas.

Description

technical field [0001] The invention relates to the technical field of microbial application, in particular to a method for degrading soil polluted by triadimenol by using a new microbial strain. Background technique [0002] Triadimenol is a triazole fungicide developed by Bayer Company in Germany. Due to its high efficiency, broad spectrum, long residual period and strong systemic conductivity, it has protective and therapeutic effects on crops and is widely used in fruits. and cereals and other crops. Triadimenol itself is a fungicide and the main metabolite of triadimefon, which has neurotoxicity and has certain effects on the morphology of the pharynx of rodent embryos. Malfunction. Different concentrations of triadimenol have different toxicity to human liver cells: at low concentrations, it significantly promotes cell proliferation, and as the concentration increases, the promoting effect increases; at high concentrations, it significantly inhibits cell proliferatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20B09C1/10C12R1/025
CPCB09C1/10C12N1/20C12N1/205C12R2001/025
Inventor 张春荣何红梅吴珉平立凤朱亚红俞建忠
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More