Unlock instant, AI-driven research and patent intelligence for your innovation.

A leukemia-related circular circRNA-016901 gene and its use

A gene, circular technology, applied in the field of circular circRNA-016901 gene, can solve the problems of transplantation failure, unclear hematopoiesis and its mechanism of action, affecting HSCs engraftment and transplantation efficacy, etc.

Inactive Publication Date: 2019-07-02
THE THIRD XIANGYA HOSPITAL OF CENT SOUTH UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The injury of bone marrow mesenchymal stem cells (BMSCs) by TBI before bone marrow transplantation may affect the implantation and transplantation efficacy of HSCs, and even lead to transplantation failure. clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A leukemia-related circular circRNA-016901 gene and its use
  • A leukemia-related circular circRNA-016901 gene and its use
  • A leukemia-related circular circRNA-016901 gene and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Amplification of circular circRNA-016901 gene primer pair

[0022] According to the cDNA sequence shown in SEQ ID NO:1 of the circular circRNA-016901 gene, primers for amplification were designed, and the specific sequences of each primer are shown in Table 1.

[0023] Table 1 Circular circRNA-016901 Gene Amplification Primer Sequence

[0024] Primer name Sequence (5'→3') SEQ.ID F ACAGCGCTACACTTGTTCCGA 2 R GACGATGCTATCCAGGAGAGGT 3

[0025] After the above primers were artificially synthesized, they were used as a primer pair for amplifying the cDNA sequence of the circular circRNA-016901 gene.

Embodiment 2

[0026] Example 2: Preparation of total RNA in the sample

[0027] According to the RNA extraction steps of TRIZOL method, the total RNA in the bone marrow stromal cell samples of the control group and the whole body irradiation treatment group was extracted. A brief description is as follows:

[0028] 1. Homogenate

[0029] According to the instructions of the TRIZOL method, the sample was homogenized after adding TRIZOL reagent according to the number of cells;

[0030] 2. Two-phase separation

[0031] After incubating the homogenized sample at 15-30°C for 5 minutes, add 0.2ml of chloroform to every 1ml of TRIZOL reagent homogenized sample, and tightly cap the tube. Shake the tube vigorously by hand for 15 seconds, and incubate at 15 to 30°C for 2 to 3 minutes. Centrifuge at 12,000 x g for 15 min at 4°C. After centrifugation, the mixed liquid will be divided into the red phenol chloroform phase of the lower layer, the colorless aqueous phase of the middle layer and the u...

Embodiment 3

[0041] Embodiment 3: the synthesis of total cDNA sequence

[0042] The total RNA that passed the quality test was synthesized according to the method described below. The reagents used in the synthesis and their manufacturers are as follows:

[0043] RNase inhibitor (Epicentre); SuperScriptTM III Reverse Transcriptase (Invitrogen); 5×RT buffer (Invitrogen); 2.5mM dNTP mixture (dATP, dGTP, dCTP and dTTP each 2.5mM) (HyTest Ltd); Jun Biotechnology Co., Ltd.)

[0044] The thermocycler used for cDNA synthesis was Gene Amp PCR System 9700 (Applied Biosystems).

[0045] The specific operation method is as follows:

[0046] 1. Prepare the annealing mixture

[0047] RNA 800ng

[0048] 0.5ug / ul Random (N9) 1μl

[0049] dNTPs Mix (2.5mM) 1.6μl

[0050] Add RNase-free H 2 O to a total volume of 14.5 μl; the mixture was placed in a water bath at 65°C for 5 minutes, and placed on ice for 2 minutes.

[0051] 2. After short centrifugation, add RT reaction solution to the centrifuge tu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a circular circRNA-016901 gene related to leukemia and a purpose thereof. Firstly, the existence of the circular circRNA-016901 gene is proved; through detecting a gene expression condition in a whole body radiation patient, the condition that the expression level of the gene is obviously raised is discovered. Marrow stromal cells transfected with an adenovirus vector of the over-expressed circular circRNA-016901 gene are compared with reference marrow stromal cells transfected with an empty vector; the conditions that the expression quantity of TGF-beta protein in the cells transfected with the adenovirus vector is obviously increased, the myelofibrosis is caused and is unfavorable for hematopoietic cell homing, self updating, proliferation and differentiation, and further the transplanting curative effect of the hematopoietic stem cells can be influenced are discovered, so that the circular circRNA-016901 gene and an expression product of the circular circRNA-016901 gene can be used as a marker for predicting the hematopoietic stem cell transplanting curative effect, and can be used as a target gene for preparing leukemia treating medicines and a medicine.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and in particular relates to a circular circRNA-016901 gene related to leukemia and its application. Background technique [0002] Leukemia, commonly known as blood cancer, has posed a huge threat to people's health because of its unknown etiology, short survival period and high mortality rate. According to statistics, there are more than 4 million leukemia patients in my country, and more than 40,000 new cases will be added every year. Hematopoietic stem cell transplantation (HSCT) is currently the first choice to cure malignant hematological diseases, and total body irradiation (TBI) is one of the necessary auxiliary means for hematopoietic stem cell (HSCs) transplantation. The purpose of TBI treatment: one is immunosuppression, mainly to enable the transplanted bone marrow to be accepted by the recipient. The second is to eliminate malignant tumor cells in the body to achieve the purpo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12Q1/6886
CPCC12Q1/6886C12Q2600/158
Inventor 聂新民张军华桂嵘黄蓉江静
Owner THE THIRD XIANGYA HOSPITAL OF CENT SOUTH UNIV