Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method and application of targeted targeting vector and targeted integration of exogenous gene into MYH9 Intron2 site for constructing mouse embryonic stem cell line

A technology for targeting vectors and exogenous genes, applied in the direction of using vectors to introduce foreign genetic material, cells and vectors modified by introducing foreign genetic material, to achieve efficient targeted integration and accurate expression

Active Publication Date: 2019-06-07
HUNAN AGRICULTURAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are very few genomic loci that can be used as safe harbors, such as ROSA26, AAVS1, CCR5 in the human genome and ROSA26 alleles in the mouse genome (Sadelain M 2011 Nature Reviews Cancer 12,51-58), and there may still be potential unknown issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and application of targeted targeting vector and targeted integration of exogenous gene into MYH9 Intron2 site for constructing mouse embryonic stem cell line
  • Method and application of targeted targeting vector and targeted integration of exogenous gene into MYH9 Intron2 site for constructing mouse embryonic stem cell line
  • Method and application of targeted targeting vector and targeted integration of exogenous gene into MYH9 Intron2 site for constructing mouse embryonic stem cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Construction of a targeting vector targeting the intron 2 site of the mouse MYH9 gene

[0031]Our previous studies have shown that the homologous recombination efficiency of exon 2 where the first ATG of the mouse MYH9 gene is replaced is as high as 90%, but this also destroys the endogenous MYH9 gene at the same time, which is not conducive to gene removal Insertion of other foreign genes other than substitution. We considered whether it is possible to integrate the exogenous gene into the intron 2 site of the MYH9 gene, so that not only can the efficient homologous recombination efficiency of this site be utilized, but also the integrity of the endogenous gene can be maintained. To this end, the mouse MYH9 genome sequence was retrieved and downloaded from the genome.ucsc.edu website, combined with the mouse MYH9 mRNA (Genbank No: NM_022410) sequence, the positions and sequences of each exon and intron were determined, especially the second Introns. Accord...

Embodiment 2

[0032] Example 2: Construction of targeting vectors for targeted integration of foreign genes

[0033] In order to enable the targeted integration of the exogenous gene into the intron 2 site of the MYH9 gene, the exogenous gene expression cassette must be inserted into the above-mentioned targeting vector mpNTKV-LoxP MAI2L-MAI2R, and the process includes the following:

[0034] Construction of EF1α-GFP-rGlobin polyA expression cassette: using pEF-GFP plasmid plasmid (Addgene) as template and using forward primer EF1a-F(Pac I) 5'-CC TTAATTAA CGTGAGGCTCCGGTGCCCGTC (SEQ ID NO.13) and reverse primer rGlobin pA-R(Pac I) 5'-CC TTAATTAA CTGCAGGTCGAGGGATCTTCAT and Platinum Taq DNA Polymerase High Fidelity were used for PCR amplification of about 2.5kb DNA fragment including human EF1α promoter, GFP expression sequence and rabbit Globin polyA termination sequence (94°C for 2min, 94°C for 30s, 60°C for 30s, 68°C for 2.5min, 30cycles, 68°C 10min), the underlined sequence is the enzy...

Embodiment 3

[0041] Example 3: Targeting vectors integrating exogenous genes into mouse embryonic stem (ES) cells

[0042] The trophoblast cells used in the present invention are Neomycin-resistant (Neomycin-resistant) mouse embryonic fibroblasts (MEFs) with γ-ray treatment; the mouse embryonic stem cell line is V6.5 with C57BL / 6 and 129S6vEv heterozygous genetic background, all from the Transgenic Center of the National Heart, Lung and Blood Institute. The MEF and ES cell culture medium DMEM used and the required additives LIF, NEAA, L-glutamine, HEPES, β-mercaptoethanol, PEN / STREP, Puromycin, etc. were purchased from Millipore Company.

[0043] The preparation of culture dishes for culturing embryonic stem cells was carried out according to the following procedures and ratios: 10cm cell culture dishes were coated with 3ml 0.1% Gelatin at 37°C for 2 hours or overnight at 4°C for later use, and then the MEF cells were quickly thawed in a water bath at 37°C, After centrifugation at 1000rpm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a target targeting vector, a method for constructing a mouse embryonic stem cell strain through targeting integration of exogenous genes to an MYH9 Intron2 locus and application. The sequence of the target targeting vector is shown as SEQ ID NO.7, and the target targeting vector is named an mpNTKV-LoxP MAI2L-MAI2R vector. A new locus sequence capable of achieving efficient, safe and targeting integration is provided. According to the targeting vector constructed based on the locus and inserted into the exogenous genes in a targeting mode, efficient targeting can be achieved, it can be guaranteed that the exogenous genes are stably expressed in mouse embryonic stem cells and endogenous gene expression is not influenced, and therefore a good platform is erected for construction of a transgenic cell line and a rat.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a targeted targeting vector and a method and application for targeting and integrating exogenous genes into the MYH9Intron2 site to construct a mouse embryonic stem cell line. Background technique [0002] Transgenic and gene knockout / knock-in technologies have become the key technologies relied on in the basic research and application development of modern life sciences. Among them, artificially isolated and modified genes are introduced into the genome of organisms, and the expression of the introduced genes causes organisms to The heritable change of traits, this technology is called transgenic technology (Transgenic technology); through homologous recombination, the exogenous gene is site-specifically integrated into a certain site on the genome of the target cell, so as to achieve site-specific modification and transformation of a certain site on the chromosome. The ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N5/10C12N15/66
CPCC12N15/8509C12N2800/107C12N2800/30
Inventor 王爱兵刘谭彬王乃东杨毅湛洋胡意杨凌宸刘伟雷红宇雷昕
Owner HUNAN AGRICULTURAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com