Method and application of targeted targeting vector and targeted integration of exogenous gene into MYH9 Intron2 site for constructing mouse embryonic stem cell line
A technology for targeting vectors and exogenous genes, applied in the direction of using vectors to introduce foreign genetic material, cells and vectors modified by introducing foreign genetic material, to achieve efficient targeted integration and accurate expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1: Construction of a targeting vector targeting the intron 2 site of the mouse MYH9 gene
[0031]Our previous studies have shown that the homologous recombination efficiency of exon 2 where the first ATG of the mouse MYH9 gene is replaced is as high as 90%, but this also destroys the endogenous MYH9 gene at the same time, which is not conducive to gene removal Insertion of other foreign genes other than substitution. We considered whether it is possible to integrate the exogenous gene into the intron 2 site of the MYH9 gene, so that not only can the efficient homologous recombination efficiency of this site be utilized, but also the integrity of the endogenous gene can be maintained. To this end, the mouse MYH9 genome sequence was retrieved and downloaded from the genome.ucsc.edu website, combined with the mouse MYH9 mRNA (Genbank No: NM_022410) sequence, the positions and sequences of each exon and intron were determined, especially the second Introns. Accord...
Embodiment 2
[0032] Example 2: Construction of targeting vectors for targeted integration of foreign genes
[0033] In order to enable the targeted integration of the exogenous gene into the intron 2 site of the MYH9 gene, the exogenous gene expression cassette must be inserted into the above-mentioned targeting vector mpNTKV-LoxP MAI2L-MAI2R, and the process includes the following:
[0034] Construction of EF1α-GFP-rGlobin polyA expression cassette: using pEF-GFP plasmid plasmid (Addgene) as template and using forward primer EF1a-F(Pac I) 5'-CC TTAATTAA CGTGAGGCTCCGGTGCCCGTC (SEQ ID NO.13) and reverse primer rGlobin pA-R(Pac I) 5'-CC TTAATTAA CTGCAGGTCGAGGGATCTTCAT and Platinum Taq DNA Polymerase High Fidelity were used for PCR amplification of about 2.5kb DNA fragment including human EF1α promoter, GFP expression sequence and rabbit Globin polyA termination sequence (94°C for 2min, 94°C for 30s, 60°C for 30s, 68°C for 2.5min, 30cycles, 68°C 10min), the underlined sequence is the enzy...
Embodiment 3
[0041] Example 3: Targeting vectors integrating exogenous genes into mouse embryonic stem (ES) cells
[0042] The trophoblast cells used in the present invention are Neomycin-resistant (Neomycin-resistant) mouse embryonic fibroblasts (MEFs) with γ-ray treatment; the mouse embryonic stem cell line is V6.5 with C57BL / 6 and 129S6vEv heterozygous genetic background, all from the Transgenic Center of the National Heart, Lung and Blood Institute. The MEF and ES cell culture medium DMEM used and the required additives LIF, NEAA, L-glutamine, HEPES, β-mercaptoethanol, PEN / STREP, Puromycin, etc. were purchased from Millipore Company.
[0043] The preparation of culture dishes for culturing embryonic stem cells was carried out according to the following procedures and ratios: 10cm cell culture dishes were coated with 3ml 0.1% Gelatin at 37°C for 2 hours or overnight at 4°C for later use, and then the MEF cells were quickly thawed in a water bath at 37°C, After centrifugation at 1000rpm...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



