Construction method and application of CD45-DTR transgenic mouse for regulating and removing immune cells by diphtheria toxin
A technology of CD45-DTR and transgenic mice, applied in other methods, applications, and immunoassays of inserting foreign genetic materials, can solve the problems of normal cells being easily affected, unstable passage, poor selectivity, etc., and achieve good immunity cell effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Construction of BAC Clone CD45-DTR vector.
[0046] (1) Construct a targeting vector that integrates foreign genes into the exon 1 site of mouse CD45, the procedure is as follows: figure 1 Shown:
[0047] The mouse CD45 genome sequence was retrieved and downloaded from the genome.ucsc.edu website, combined with the mouse CD45 (Genbank No: NM_001111316.2) sequence, the positions and sequences of each exon and intron were determined. BAC Clone containing the entire CD45 gene: RP23-180D23 was purchased from Children’s hospital Oakland Research Institute, and BAC DNA was used HiPure Plasmid Filter Maxiprep Kit (Invitrogen) was prepared for use.
[0048] The target gene fragment CD45 5' side homology arm (CD45 5HA) was amplified by PCR: using RP23-180D23 BAC DNA as a template, using the forward primer CD45-5HA-F(KpnI)-ACCACCGGTACCGTGCAAAGTATGCGTTCTTTTCTTTAG(SEQ ID NO.1), The reverse primer CD45-5HA-R(SalI)-AACAACGTCGAC ATCTGGAGATCAGCTGTGCCC (SEQ ID NO.2) was used for PCR...
Embodiment 2
[0077] Insertion of CD45-DTR into mouse embryonic stem (ES) cells:
[0078] Mouse embryonic fibroblasts (MEFs) culture: MEFs (ATCC) were cultured and maintained in MEF medium, passaged and frozen in time. The MEF medium is DMEM medium supplemented with 10% FBS, 100 U / ml penicillin streptomycin, 0.05 mM 2-mercaptoethanol, and 2 mM L-glutamine.
[0079] Balb / c ES cell culture: MEFs cells were inactivated with 30 Gray γ-rays before use as trophoblast cells, Balb / c ES cells (Merck) were inoculated onto the inactivated MEFs, cultured and maintained with ES medium. ES cells were grown to 70% abundance and passaged at a ratio of 1:3. ES medium is DMEM medium with 15% FBS, 100U / ml penicillin, 1mM sodium pyruvate, 0.1mM non-essential amino acid, 0.05mM 2-mercaptoethanol, 2mM L-glutamine, 1μg / L leukemia inhibitory factor (LIF).
[0080] Electroporation of ES cells: ES cells were collected by trypsinization, washed once with PBS, resuspended in electroporation buffer (Millipore), and ...
Embodiment 3
[0089] Breeding BAC clone CD45-DTR transgenic mice, the procedure is as attached Figure 7 shown.
[0090] Blastocyst injection of ES cells to obtain CD45-DTR transgenic chimera mice: Select 8-week-old well-developed C57BL / 6J male mice and C57BL / 6J female mice in a 1:2 cage, and select vaginal plug-positive female mice in the morning of the next day , if the female mouse is pregnant 5 days later, blastocysts can be obtained in the uterus. Ligated KM male mice and normal KM female mice were caged at a ratio of 1:2, and the female mice with vaginal plugs and swollen and ruddy vulva were selected as pseudopregnant KM female mice. ES cells inserted into CD45-DTR were injected into C57BL / 6J mouse blastocysts, and then inoculated into the uterus of pseudopregnant KM female mice, and chimeric mice (F0) were born, that is, cells derived from C57 and BALB / c The derived ES cells co-exist in the same individual, and the animal coat color is black and white mixed.
[0091] Method for e...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com