Targeting vector, construction method for transgenic mouse capable of regulating and removing monocyte-derived DC via diphtheria toxin, and application of targeting vector

A technology for transgenic mice and targeting vectors, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, applications, etc.

CN111088280APending Publication Date: 2020-05-01THE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE
0 Cites 3 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2020-05-01

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention relates to the field of animal model construction. The invention discloses a targeting vector, a construction method for a transgenic mouse capable of regulating and removing monocyte-derived DC via the diphtheria toxin, and application of targeting vector. To overcome the defects of existing dendritic cell removal animal models, the invention provides preparation, application and detection methods for a novel inducible DCSIGN-DTR transgenic mouse animal model capable of regulating and removing monocyte-derived DC via the diphtheria toxin, wherein the novel inducible DCSIGN-DTR transgenic mouse animal model is capable of realizing stable passage. The constructed DCSIGN-DTR transgenic mouse animal model for regulating and removing the monocyte-derived DC via the diphtheria toxin has the advantages that monocyte-derived DC removal efficiency reaches 80 to 90%, and the monocyte-derived DC can be better removed; and the function of the monocyte-derived DC is not affected whendiphtheria toxin induction is not used, and no side reaction is caused when the diphtheria toxin induction is used for removing the monocyte-derived DC. Thus, a brand-new monocyte-derived DC removalprinciple and method are provided, and the brand-new monocyte-derived DC inducible removal animal model is provided.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The present invention relates to the field of animal model construction, and more specifically relates to a method and application of a targeting carrier and a transgenic mouse for regulating and eliminating monocyte-derived dendritic cells by diphtheria toxin. Background technique

[0002] Dendritic cells (MDCs) are the most powerful antigen-presenting cells in the body known so far, and the only antigen-presenting cells that can activate unsensitized naive T cells. Maintain the immune response center. Dendritic cells originate from hematopoietic stem cells in the bone marrow. On the one hand, myeloid stem cells can differentiate into myeloid DCs, also known as DC1, including Langerhans cells, mesenchymal DCs, and monocyte-derived DCs; on the other hand, lymphoid Lymphoid-like stem cells can differentiate into lymphoid-like DCs, also known as DC2. When monocytes in peripheral blood can differentiate into DCs under the stimulation of GM-CSF and IL-4,...

Examples

Embodiment 1

[0053] Example 1: Construction of a targeting vector with a long homology arm that targets the integration of the exogenous gene IRES-DTR into exon 7 of DC-SIGN.

[0054] The mouse DC-SIGN genome sequence was retrieved and downloaded from the genome.ucsc.edu website, combined with the mouse DC-SIGN (Genbank No: NM_133238.5) sequence, the positions and sequences of each exon and intron were determined. The BAC Clone containing the entire DC-SIGN gene: RP23-12K14 was purchased from the Children’hospotal Oakland Research Institute, and the BAC DNA was used HiPure Plasmid Filter Maxiprep Kit (Invitrogen) was prepared for use.

[0055] PCR amplification of the DC-SIGN 5' side homology arm (retrieval 5HA) and DC-SIGN 3' side homology arm (retrieval 3HA) of the target gene fragment: using RP23-12K14 BAC DNA as a template, using the forward primer DCSIGN-5HA -F(NotI)-ACCACC GCGGCCGC ACATCTGCCCATAGCACACAG (SEQ ID NO.1) and reverse primer DCSIGN-5HA-R (SpeI)-ACCACC ACTAGT AGCATCAG...

Embodiment 2

[0070] Example 2: Preparation of mouse embryonic stem (ES) cells targeted to insert IRES-DTR into DC-SIGN exon 7

[0071] Mouse embryonic fibroblasts (MEFs) culture: MEFs (ATCC) were cultured and maintained in MEF medium, passaged and frozen in time. MEF medium is DMEM medium with 10% FBS, 100U / ml penicillin streptomycin, 0.05mM 2mercaptoethanol, 2mML-glutamine.

[0072] Balb / c ES cell culture: MEFs cells were inactivated with 30 Gray γ-rays before use as trophoblast cells, Balb / c ES cells (Merck) were inoculated onto the inactivated MEFs, cultured and maintained with ES medium. ES cells were grown to 70% abundance and passaged at a ratio of 1:3. ES medium is DMEM medium with 15% FBS, 100U / ml penicillin, 1mM sodium pyruvate, 0.1mM non-essential amino acid, 0.05mM 2-mercaptoethanol, 2mM L-glutamine, 1μg / L leukemia inhibitory factor (LIF).

[0073] Electroporation of ES cells: ES cells were collected by trypsinization, washed once with PBS, resuspended in electroporation buff...

example 3

[0080] Example 3: Breeding DC SIGN-DTR transgenic mice with targeted insertion of IRES-DTR into DC-SIGN exon 7

[0081] Blastocyst injection of ES cells to obtain DC SIGN-DTR transgenic chimeric mice: Select 8-week-old well-developed C57BL / 6J male mice and C57BL / 6J female mice in a 1:2 cage, and select vaginal plug-positive females in the morning of the next day For mice, blastocysts can be obtained in the uterus if the female mouse is pregnant for 5 days. Ligated KM male mice and normal KM female mice were caged at a ratio of 1:2, and the female mice with vaginal plugs and swollen and ruddy vulva were selected as pseudopregnant KM female mice. The ES cells targeted to insert IRES-DTR to the DC-SIGN exon 7 site were injected into C57BL / 6J mouse blastocysts, and then inoculated into the uterus of pseudopregnant KM female mice, and chimeric mice were born ( F0), that is, cells derived from C57 and ES cells derived from BALB / c co-exist in the same individual, and the coat color ...