Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Targeting vector, construction method for transgenic mouse capable of regulating and removing monocyte-derived DC via diphtheria toxin, and application of targeting vector

A technology for transgenic mice and targeting vectors, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, applications, etc.

Pending Publication Date: 2020-05-01
THE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies of the existing dendritic cell elimination animal models, and to provide a method for constructing and applying a transgenic mouse that regulates and eliminates monocyte-derived dendritic cells with a targeting carrier and diphtheria toxin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Targeting vector, construction method for transgenic mouse capable of regulating and removing monocyte-derived DC via diphtheria toxin, and application of targeting vector
  • Targeting vector, construction method for transgenic mouse capable of regulating and removing monocyte-derived DC via diphtheria toxin, and application of targeting vector
  • Targeting vector, construction method for transgenic mouse capable of regulating and removing monocyte-derived DC via diphtheria toxin, and application of targeting vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1: Construction of a targeting vector with a long homology arm that targets the integration of the exogenous gene IRES-DTR into exon 7 of DC-SIGN.

[0054] The mouse DC-SIGN genome sequence was retrieved and downloaded from the genome.ucsc.edu website, combined with the mouse DC-SIGN (Genbank No: NM_133238.5) sequence, the positions and sequences of each exon and intron were determined. The BAC Clone containing the entire DC-SIGN gene: RP23-12K14 was purchased from the Children’hospotal Oakland Research Institute, and the BAC DNA was used HiPure Plasmid Filter Maxiprep Kit (Invitrogen) was prepared for use.

[0055] PCR amplification of the DC-SIGN 5' side homology arm (retrieval 5HA) and DC-SIGN 3' side homology arm (retrieval 3HA) of the target gene fragment: using RP23-12K14 BAC DNA as a template, using the forward primer DCSIGN-5HA -F(NotI)-ACCACC GCGGCCGC ACATCTGCCCATAGCACACAG (SEQ ID NO.1) and reverse primer DCSIGN-5HA-R (SpeI)-ACCACC ACTAGT AGCATCAG...

Embodiment 2

[0070] Example 2: Preparation of mouse embryonic stem (ES) cells targeted to insert IRES-DTR into DC-SIGN exon 7

[0071] Mouse embryonic fibroblasts (MEFs) culture: MEFs (ATCC) were cultured and maintained in MEF medium, passaged and frozen in time. MEF medium is DMEM medium with 10% FBS, 100U / ml penicillin streptomycin, 0.05mM 2mercaptoethanol, 2mML-glutamine.

[0072] Balb / c ES cell culture: MEFs cells were inactivated with 30 Gray γ-rays before use as trophoblast cells, Balb / c ES cells (Merck) were inoculated onto the inactivated MEFs, cultured and maintained with ES medium. ES cells were grown to 70% abundance and passaged at a ratio of 1:3. ES medium is DMEM medium with 15% FBS, 100U / ml penicillin, 1mM sodium pyruvate, 0.1mM non-essential amino acid, 0.05mM 2-mercaptoethanol, 2mM L-glutamine, 1μg / L leukemia inhibitory factor (LIF).

[0073] Electroporation of ES cells: ES cells were collected by trypsinization, washed once with PBS, resuspended in electroporation buff...

example 3

[0080] Example 3: Breeding DC SIGN-DTR transgenic mice with targeted insertion of IRES-DTR into DC-SIGN exon 7

[0081] Blastocyst injection of ES cells to obtain DC SIGN-DTR transgenic chimeric mice: Select 8-week-old well-developed C57BL / 6J male mice and C57BL / 6J female mice in a 1:2 cage, and select vaginal plug-positive females in the morning of the next day For mice, blastocysts can be obtained in the uterus if the female mouse is pregnant for 5 days. Ligated KM male mice and normal KM female mice were caged at a ratio of 1:2, and the female mice with vaginal plugs and swollen and ruddy vulva were selected as pseudopregnant KM female mice. The ES cells targeted to insert IRES-DTR to the DC-SIGN exon 7 site were injected into C57BL / 6J mouse blastocysts, and then inoculated into the uterus of pseudopregnant KM female mice, and chimeric mice were born ( F0), that is, cells derived from C57 and ES cells derived from BALB / c co-exist in the same individual, and the coat color ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of animal model construction. The invention discloses a targeting vector, a construction method for a transgenic mouse capable of regulating and removing monocyte-derived DC via the diphtheria toxin, and application of targeting vector. To overcome the defects of existing dendritic cell removal animal models, the invention provides preparation, application and detection methods for a novel inducible DCSIGN-DTR transgenic mouse animal model capable of regulating and removing monocyte-derived DC via the diphtheria toxin, wherein the novel inducible DCSIGN-DTR transgenic mouse animal model is capable of realizing stable passage. The constructed DCSIGN-DTR transgenic mouse animal model for regulating and removing the monocyte-derived DC via the diphtheria toxin has the advantages that monocyte-derived DC removal efficiency reaches 80 to 90%, and the monocyte-derived DC can be better removed; and the function of the monocyte-derived DC is not affected whendiphtheria toxin induction is not used, and no side reaction is caused when the diphtheria toxin induction is used for removing the monocyte-derived DC. Thus, a brand-new monocyte-derived DC removalprinciple and method are provided, and the brand-new monocyte-derived DC inducible removal animal model is provided.

Description

technical field [0001] The present invention relates to the field of animal model construction, and more specifically relates to a method and application of a targeting carrier and a transgenic mouse for regulating and eliminating monocyte-derived dendritic cells by diphtheria toxin. Background technique [0002] Dendritic cells (MDCs) are the most powerful antigen-presenting cells in the body known so far, and the only antigen-presenting cells that can activate unsensitized naive T cells. Maintain the immune response center. Dendritic cells originate from hematopoietic stem cells in the bone marrow. On the one hand, myeloid stem cells can differentiate into myeloid DCs, also known as DC1, including Langerhans cells, mesenchymal DCs, and monocyte-derived DCs; on the other hand, lymphoid Lymphoid-like stem cells can differentiate into lymphoid-like DCs, also known as DC2. When monocytes in peripheral blood can differentiate into DCs under the stimulation of GM-CSF and IL-4,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/65C12N15/66C12N5/10C12N15/89C12N15/877A01K67/027
CPCC12N15/8509C12N15/65C12N15/66C12N15/89C12N15/8775C07K14/475A01K67/0278C12N2800/30A01K2207/15A01K2217/072A01K2227/105A01K2267/03
Inventor 盛剑鹏梁廷波白雪莉汤江辉
Owner THE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com