Novel catalase signal sequence and method for catalase expression using same

A technology for signal sequence and sequence representation, which is applied in the field of mass production of catalase, and can solve the problem of inability to express proteins in large quantities.

Active Publication Date: 2017-02-22
GENOFOCUS CO LTD
View PDF16 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, it is currently not possible to express the desired protein in large quantities through only the currently known signal sequence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel catalase signal sequence and method for catalase expression using same
  • Novel catalase signal sequence and method for catalase expression using same
  • Novel catalase signal sequence and method for catalase expression using same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1: Preparation of expression vectors pASPW504 and pASPW505

[0045] 1-1: Chemical synthesis of An07g00440 lipase signal sequence and An07g00440 lipase variant signal sequence

[0046] In order to secrete catalase to the outside of Aspergillus niger, the An07g00440 lipase signal sequence and the An07g00440 lipase variant signal sequence represented by SEQ ID NO: 3 or 4 were chemically synthesized. The amino acid sequence of the protein encoded by the An07g00440 lipase signal sequence and the An07g00440 lipase variant signal sequence of SEQ ID NO: 3 or SEQ ID NO: 4 is the following SEQ ID NO: 1 or SEQ ID NO: 2, respectively.

[0047] The An07g00440 lipase signal sequence of SEQ ID NO: 1 consists of 2 amino acids in the N-domain, 12 amino acids in the H-domain, and 5 amino acids in the C-domain (19 amino acids in total). The An07g00440 lipase modification signal sequence of SEQ ID NO: 2 is to convert tyrosine as the second amino acid into a positively charged argi...

Embodiment 2

[0059] Embodiment 2: Preparation of catalase expression vectors pASP503PMC, pASPW504PMC and pASPV505PMC

[0060] The catalase protein code of sequence number 5 from Penicillium marneffei has a total of 734 amino acids, and includes 19 signal sequence (mrglyslgtlaglvvaasa) and 23 presequence (acpmltgelpagsvanphhhgkr) amino acids. By making the two ends of the base sequence of PMC (Penicillium marneffei catalase) have the recognition sites of the restriction enzyme ClaI and the restriction enzyme NotI respectively, the 2205bp size of SEQ ID NO: 6 was derived from Penicillium marneffei. The catalase gene was chemically synthesized and cloned in the pGEM-B1 vector.

[0061] The PMC DNA containing the signal sequence was cut with ClaI and NotI, cloned into the pASPF503 vector of Example 1-1, and named pASP503PMC.

[0062] PMC DNA that does not contain a signal sequence in SEQ ID NO: 6, by using the PMCVF1 primer (gcctgcccaatgctgacaggcg) of SEQ ID NO: 7 that does not have a restric...

Embodiment 3

[0063] Embodiment 3: the preparation of the recombinant microorganism that introduces expression vector and the screening method of recombinant microorganism

[0064] The expression vectors pASP503PMC, pASPW504PMC and pASPV505PMC of Example 2 were introduced into Aspergillus niger for transformation (Tilburn et al., Gene., 26:205-221, 1983). For transformation, pASP600s DNA was inserted into the genome after liquid cultured mycelia were treated with cell wall degrading enzymes to prepare protoplasts. Furthermore, in order to select recombinant microorganisms, the selection was carried out on an agar medium supplemented with hygromycin, followed by subculture.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a novel signal sequence for mass-expression of catalase and a use thereof and, more specifically, to a novel lipase signal sequence; an expression vector comprising the signal sequence and a catalase gene; a recombinant microorganism into which the expression vector is introduced; and a method for mass-producing catalase by culturing the recombinant microorganism. The use of the expression vector comprising the novel signal sequence, according to the present invention, can induce mass expression and secretion of particular catalase and other target proteins, and thus the expression vector is very useful in the stable mass production of the particular catalase and other target proteins.

Description

technical field [0001] The present invention relates to novel signal sequence and application thereof for mass expression of catalase, more specifically, to novel lipase signal sequence, expression vector comprising said signal sequence and catalase gene, introduced with said expression A recombinant microorganism of the vector and a method for mass-producing catalase by culturing the recombinant microorganism. Background technique [0002] Catalase is the enzyme that promotes hydrogen peroxide (H 2 o 2 ) into oxygen (O 2 ) and water (H 2 O) enzymes. Most catalase enzymes comprise 4 kinds of polypeptide subunits, the 4 kinds of polypeptide subunits have molecular weights of 50000 to 60000 respectively, and each subunit has a heme (Heme) (Wasserman and Hultin (1981) Arch. Biochem. Biophys. 212:385-392; Hartig and Ruis (1986) Eur. J. Biochem. 160:487-490). [0003] Conventionally, various proteins for industrial use have been produced by using Saccharomyces, Aspergillus ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/20C12N15/55C12N1/21C12N15/09
CPCC12N9/20C12N15/09C12N9/0065C12N15/63C12N15/74C12Y301/01003
Inventor 潘在龟金义中李东范金恩英
Owner GENOFOCUS CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products