A kind of preparation method and application of soluble housefly mdpropo1 recombinant protein
A recombinant protein, soluble technology, applied in the field of genetic engineering, can solve the problems of unknown efficacy and unclear whether MdproPO1 protein has
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0100] Expression of MdproPO1 recombinase
[0101] The main steps include:
[0102] Use a 1 mL sterile syringe needle to dip in an equal amount of mixed E. coli ( Escherichia coli ) and Staphylococcus aureus ( Staphylococcus aureus ) live bacteria solution (concentration about 3 * 10 8 cfu / mL), in the hind abdomen of the third instar larvae of Housefly stinging housefly, one needle per larva, transferred to fresh medium and reared for 4 h, extracted the total RNA stimulated by housefly reverse transcription into cDNA as a template, and synthesized containing Kpn I and Sal The forward and reverse primers of the I endonuclease site, the primer sequence is:
[0103] mdproPO1 ExF: 5'-TAGatc GGTACC ATGACTGACAAAAAGAATCTCC—3' (SEQ ID NO. 3)
[0104] mdproPO1 ExR: 5'-TAG GTC GAC GCTGGCTGGAGAAAACTTAT - 3' (SEQ ID NO. 4);
[0105] After polymerase chain reaction (PCR), amplified 2055 bp mdproPO1 The ORF of the gene was cloned into pET-30a plasmid (Invitrogen), and ...
Embodiment 2
[0107] Purification, Denaturation and Refolding of MdproPO1 Inclusion Body
[0108] The main steps include:
[0109] ⅰ. Purification of inclusion bodies: Centrifuge the induced bacterium solution with the maximum expression of MdproPO1 at 7000 rpm for 10 min, collect the bacterium, and wash with l × PBS (140 mM NaCl, 2.7 mM KCl, 10 mM NaCl 2 HPO 4 ,1.8 Mm KH 2 PO 4 , pH 7.4), resuspended, ultrasonicated in an ice bath, centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant and precipitate were collected separately. The expressed MdproPO1 recombinant protein was all in the precipitate, which was an inclusion body, and the size was the same as the expected 83.5 kDa match, including mdproPO1 The encoded protein of the 2055 bp ORF of the gene is 79.3 kDa, and the His tag on the vector is about 4.2 kDa ( figure 2 ).
[0110] ⅱ. Denaturation of inclusion bodies: Suspend the MdproPO1 inclusion bodies collected by centrifugation with Buffer A (50 mM Tris-HCl, 5 mM EDT...
Embodiment 3
[0120] Application of MdproPO1 refolding protein
[0121] mainly includes:
[0122]ⅰ. Oxidant: MdproPO1 refolding protein is converted into MdPO1 by heating or activated by chemical reagents such as ethanol. MdPO1 is an oxidizing agent for oxidizing phenolic substances. Therefore, MdproPO1 refolding protein can be developed into an oxidizing agent.
[0123] ⅱ. Melanizing agent: MdproPO1 refolding protein is heated or Ca 2+ Activated by ions to form MdPO1, MdPO1 catalyzes the formation of melanin, therefore, MdproPO1 refolding protein can be developed as a melanizing agent.
[0124] ⅲ. Fly killer and immune agent: Divide housefly larvae into four groups, and do the following treatments respectively: Group 1, no injection; Group 2, inject 0.4 μl (3×10 8 CFU / mL) Escherichia coli; Group 3, first injected 0.4 μl MdproPO1 antiserum, and then injected 0.4 μl Escherichia coli (3×10 8 CFU / mL); in group 4, 0.4 μl of pre-serum was injected first, and 0.4 μl of Escherichia coli (3×10...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com